FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628723_at:

>probe:Drosophila_2:1628723_at:488:161; Interrogation_Position=410; Antisense; AAATCGACGAAATCTTTGGAACAGT
>probe:Drosophila_2:1628723_at:167:559; Interrogation_Position=427; Antisense; GGAACAGTTCGGGACTACAGCGTGT
>probe:Drosophila_2:1628723_at:13:123; Interrogation_Position=445; Antisense; AGCGTGTCCATCAAGCTGTCGGACA
>probe:Drosophila_2:1628723_at:291:599; Interrogation_Position=461; Antisense; TGTCGGACAACGTCTACGCCAACAG
>probe:Drosophila_2:1628723_at:208:673; Interrogation_Position=475; Antisense; TACGCCAACAGCTTCAAGCCAAATC
>probe:Drosophila_2:1628723_at:384:391; Interrogation_Position=501; Antisense; GAAACTGTTTATCGACCCTGGAAAG
>probe:Drosophila_2:1628723_at:1:587; Interrogation_Position=519; Antisense; TGGAAAGCTGTTACCCATCGCCAGA
>probe:Drosophila_2:1628723_at:418:39; Interrogation_Position=535; Antisense; ATCGCCAGATTTCTGCCGAAACCTC
>probe:Drosophila_2:1628723_at:1:577; Interrogation_Position=571; Antisense; GGCGCCAAGAAAGCCTTCACAAATA
>probe:Drosophila_2:1628723_at:446:523; Interrogation_Position=786; Antisense; GGGTCGGTGGTAGTTTTCAGTATCA
>probe:Drosophila_2:1628723_at:147:235; Interrogation_Position=842; Antisense; AATCCAATTGTTGTACATGTCCAAA
>probe:Drosophila_2:1628723_at:458:479; Interrogation_Position=869; Antisense; GTTTCTAAGCAAAACCTCATCATTT
>probe:Drosophila_2:1628723_at:93:281; Interrogation_Position=884; Antisense; CTCATCATTTGGGTATTGTTCGCTG
>probe:Drosophila_2:1628723_at:490:529; Interrogation_Position=894; Antisense; GGGTATTGTTCGCTGACCAATCAAT

Paste this into a BLAST search page for me
AAATCGACGAAATCTTTGGAACAGTGGAACAGTTCGGGACTACAGCGTGTAGCGTGTCCATCAAGCTGTCGGACATGTCGGACAACGTCTACGCCAACAGTACGCCAACAGCTTCAAGCCAAATCGAAACTGTTTATCGACCCTGGAAAGTGGAAAGCTGTTACCCATCGCCAGAATCGCCAGATTTCTGCCGAAACCTCGGCGCCAAGAAAGCCTTCACAAATAGGGTCGGTGGTAGTTTTCAGTATCAAATCCAATTGTTGTACATGTCCAAAGTTTCTAAGCAAAACCTCATCATTTCTCATCATTTGGGTATTGTTCGCTGGGGTATTGTTCGCTGACCAATCAAT

Full Affymetrix probeset data:

Annotations for 1628723_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720