FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628725_at:

>probe:Drosophila_2:1628725_at:394:167; Interrogation_Position=1279; Antisense; AAACTGGACACTGACGAGGCGGGAA
>probe:Drosophila_2:1628725_at:464:91; Interrogation_Position=1322; Antisense; AGTATCTCAAGGAACGCATCTGCGA
>probe:Drosophila_2:1628725_at:551:455; Interrogation_Position=1389; Antisense; GATACCCGAAAGAAAGCTCCATGTC
>probe:Drosophila_2:1628725_at:720:495; Interrogation_Position=1411; Antisense; GTCAGCGTTGCCGAATTACCTAACT
>probe:Drosophila_2:1628725_at:603:673; Interrogation_Position=1426; Antisense; TTACCTAACTTTTTGGCCCATACTG
>probe:Drosophila_2:1628725_at:356:653; Interrogation_Position=1490; Antisense; TCAAGCGCTGCCAGGAGCTGAGCAA
>probe:Drosophila_2:1628725_at:691:435; Interrogation_Position=1519; Antisense; GAGGATGTGCCACCGTTCGAGATAC
>probe:Drosophila_2:1628725_at:624:95; Interrogation_Position=1538; Antisense; AGATACCCAAGCTGGACATCGTCGA
>probe:Drosophila_2:1628725_at:12:219; Interrogation_Position=1600; Antisense; AAGTCCCCATCCATTCAAGAGGGTG
>probe:Drosophila_2:1628725_at:294:49; Interrogation_Position=1639; Antisense; ATGCCCGTTTGCTACTACAATCTAT
>probe:Drosophila_2:1628725_at:429:161; Interrogation_Position=1655; Antisense; ACAATCTATTCGCTGGACGGGCACA
>probe:Drosophila_2:1628725_at:319:581; Interrogation_Position=1730; Antisense; TGGCCACCGCAGACGATGACAACGA
>probe:Drosophila_2:1628725_at:537:55; Interrogation_Position=1745; Antisense; ATGACAACGAAGTGCCATCCCGCAA
>probe:Drosophila_2:1628725_at:160:329; Interrogation_Position=1812; Antisense; GCGGCGAAAACCATTTAGACCCACA

Paste this into a BLAST search page for me
AAACTGGACACTGACGAGGCGGGAAAGTATCTCAAGGAACGCATCTGCGAGATACCCGAAAGAAAGCTCCATGTCGTCAGCGTTGCCGAATTACCTAACTTTACCTAACTTTTTGGCCCATACTGTCAAGCGCTGCCAGGAGCTGAGCAAGAGGATGTGCCACCGTTCGAGATACAGATACCCAAGCTGGACATCGTCGAAAGTCCCCATCCATTCAAGAGGGTGATGCCCGTTTGCTACTACAATCTATACAATCTATTCGCTGGACGGGCACATGGCCACCGCAGACGATGACAACGAATGACAACGAAGTGCCATCCCGCAAGCGGCGAAAACCATTTAGACCCACA

Full Affymetrix probeset data:

Annotations for 1628725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720