FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628727_at:

>probe:Drosophila_2:1628727_at:126:635; Interrogation_Position=1486; Antisense; TCGCCAAGTGTTTCCCGTTCGGAAG
>probe:Drosophila_2:1628727_at:397:377; Interrogation_Position=1533; Antisense; GAAGCAGCCCATGAAGTTGAGCACA
>probe:Drosophila_2:1628727_at:652:91; Interrogation_Position=1547; Antisense; AGTTGAGCACATTCTTATCGGCTGT
>probe:Drosophila_2:1628727_at:65:395; Interrogation_Position=1592; Antisense; GAAATCCCCATGTTTCCGCAAAAAG
>probe:Drosophila_2:1628727_at:124:161; Interrogation_Position=1669; Antisense; ACAAGTACAGATTCCGCTGCAGGAG
>probe:Drosophila_2:1628727_at:719:73; Interrogation_Position=1689; Antisense; AGGAGCTCCTTTTCGTTTCAACGCA
>probe:Drosophila_2:1628727_at:542:427; Interrogation_Position=1717; Antisense; GAGTCAATGCCGATATCCAAGCCCG
>probe:Drosophila_2:1628727_at:25:619; Interrogation_Position=1743; Antisense; TGCAGAAGTTCCTTCGCGTTCCAAC
>probe:Drosophila_2:1628727_at:92:335; Interrogation_Position=1777; Antisense; GCTGTACTCAAGATGGCAACGCCGA
>probe:Drosophila_2:1628727_at:618:181; Interrogation_Position=1818; Antisense; AAAACCGTCCCTATGGTTGCCATAT
>probe:Drosophila_2:1628727_at:680:31; Interrogation_Position=1841; Antisense; ATAATGTGCGACCAGCGGCATCGAT
>probe:Drosophila_2:1628727_at:669:549; Interrogation_Position=1933; Antisense; GGAATTTTAATTCCAGTCCTGGCGA
>probe:Drosophila_2:1628727_at:99:375; Interrogation_Position=1956; Antisense; GAAGTTATTAGCTTGCCACTCAGCA
>probe:Drosophila_2:1628727_at:339:361; Interrogation_Position=1978; Antisense; GCAAGCATGCTGAAGATCCCGACCA

Paste this into a BLAST search page for me
TCGCCAAGTGTTTCCCGTTCGGAAGGAAGCAGCCCATGAAGTTGAGCACAAGTTGAGCACATTCTTATCGGCTGTGAAATCCCCATGTTTCCGCAAAAAGACAAGTACAGATTCCGCTGCAGGAGAGGAGCTCCTTTTCGTTTCAACGCAGAGTCAATGCCGATATCCAAGCCCGTGCAGAAGTTCCTTCGCGTTCCAACGCTGTACTCAAGATGGCAACGCCGAAAAACCGTCCCTATGGTTGCCATATATAATGTGCGACCAGCGGCATCGATGGAATTTTAATTCCAGTCCTGGCGAGAAGTTATTAGCTTGCCACTCAGCAGCAAGCATGCTGAAGATCCCGACCA

Full Affymetrix probeset data:

Annotations for 1628727_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720