Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628728_at:

>probe:Drosophila_2:1628728_at:164:475; Interrogation_Position=1434; Antisense; GTTAAGCCCTAGACACACCTGAGAA
>probe:Drosophila_2:1628728_at:59:389; Interrogation_Position=1456; Antisense; GAAAAAGCCTGCACCACTTTGTTTT
>probe:Drosophila_2:1628728_at:330:459; Interrogation_Position=1578; Antisense; GATATAGGTTTCTTCTCAGGTGCAA
>probe:Drosophila_2:1628728_at:439:185; Interrogation_Position=1633; Antisense; AAAATCACTAGCTATACCGCATGCC
>probe:Drosophila_2:1628728_at:472:131; Interrogation_Position=1648; Antisense; ACCGCATGCCCCTACTATTGAAAAA
>probe:Drosophila_2:1628728_at:208:651; Interrogation_Position=1681; Antisense; TAATTCCATTTTCTACTACTCCGCA
>probe:Drosophila_2:1628728_at:506:515; Interrogation_Position=1792; Antisense; GTGTAGTCTAGAAACTTCCATGTAT
>probe:Drosophila_2:1628728_at:141:707; Interrogation_Position=1841; Antisense; TTAAATTAGGGCTCATTCAATGCGA
>probe:Drosophila_2:1628728_at:572:393; Interrogation_Position=1870; Antisense; GAAATGGATACTACTCACGTTATAT
>probe:Drosophila_2:1628728_at:389:201; Interrogation_Position=1895; Antisense; AACCGAGTGGTATACATTTCATCAA
>probe:Drosophila_2:1628728_at:516:233; Interrogation_Position=1936; Antisense; AATGCGATTGTAATTTCCGAATGAA
>probe:Drosophila_2:1628728_at:90:703; Interrogation_Position=1968; Antisense; TTATTCCATCTGAAGTGCTTTGCAC
>probe:Drosophila_2:1628728_at:361:509; Interrogation_Position=1982; Antisense; GTGCTTTGCACTCAATCAATTGCGA
>probe:Drosophila_2:1628728_at:469:237; Interrogation_Position=2008; Antisense; AATCGTGATGCGATGCGACGGATTC

Paste this into a BLAST search page for me
GTTAAGCCCTAGACACACCTGAGAAGAAAAAGCCTGCACCACTTTGTTTTGATATAGGTTTCTTCTCAGGTGCAAAAAATCACTAGCTATACCGCATGCCACCGCATGCCCCTACTATTGAAAAATAATTCCATTTTCTACTACTCCGCAGTGTAGTCTAGAAACTTCCATGTATTTAAATTAGGGCTCATTCAATGCGAGAAATGGATACTACTCACGTTATATAACCGAGTGGTATACATTTCATCAAAATGCGATTGTAATTTCCGAATGAATTATTCCATCTGAAGTGCTTTGCACGTGCTTTGCACTCAATCAATTGCGAAATCGTGATGCGATGCGACGGATTC

Full Affymetrix probeset data:

Annotations for 1628728_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime