Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628729_at:

>probe:Drosophila_2:1628729_at:635:675; Interrogation_Position=3790; Antisense; TAGGTTCTTAAGCAAGCCGTGTTTA
>probe:Drosophila_2:1628729_at:645:209; Interrogation_Position=3799; Antisense; AAGCAAGCCGTGTTTATATATATTA
>probe:Drosophila_2:1628729_at:200:687; Interrogation_Position=3830; Antisense; TATAGCCAGTAGATTGTACTCTAAA
>probe:Drosophila_2:1628729_at:611:483; Interrogation_Position=3845; Antisense; GTACTCTAAAACATCTATAAACGAA
>probe:Drosophila_2:1628729_at:241:139; Interrogation_Position=3895; Antisense; ACGTAGAATTTAACGCGCGGCGAAG
>probe:Drosophila_2:1628729_at:414:609; Interrogation_Position=3960; Antisense; TGAGAAAACCCCAAAACATCTGTAA
>probe:Drosophila_2:1628729_at:715:361; Interrogation_Position=4025; Antisense; GCAATTGTAGATTTTTTAATAAGCC
>probe:Drosophila_2:1628729_at:208:657; Interrogation_Position=4044; Antisense; TAAGCCCCCCTAAGAGAAAAATCAT
>probe:Drosophila_2:1628729_at:25:273; Interrogation_Position=4066; Antisense; CATTAAAAATACAACCACAAGCGAA
>probe:Drosophila_2:1628729_at:467:329; Interrogation_Position=4135; Antisense; GCGGTAATTTTTAATGAATAGGCAC
>probe:Drosophila_2:1628729_at:632:149; Interrogation_Position=4151; Antisense; AATAGGCACGTGAAGTTTAGTTACT
>probe:Drosophila_2:1628729_at:112:509; Interrogation_Position=4160; Antisense; GTGAAGTTTAGTTACTTAGTACTGT
>probe:Drosophila_2:1628729_at:391:89; Interrogation_Position=4177; Antisense; AGTACTGTACTTTCTATATAAGCAA
>probe:Drosophila_2:1628729_at:319:159; Interrogation_Position=4333; Antisense; AAATGCTAAACGACAAACTTGAAAT

Paste this into a BLAST search page for me
TAGGTTCTTAAGCAAGCCGTGTTTAAAGCAAGCCGTGTTTATATATATTATATAGCCAGTAGATTGTACTCTAAAGTACTCTAAAACATCTATAAACGAAACGTAGAATTTAACGCGCGGCGAAGTGAGAAAACCCCAAAACATCTGTAAGCAATTGTAGATTTTTTAATAAGCCTAAGCCCCCCTAAGAGAAAAATCATCATTAAAAATACAACCACAAGCGAAGCGGTAATTTTTAATGAATAGGCACAATAGGCACGTGAAGTTTAGTTACTGTGAAGTTTAGTTACTTAGTACTGTAGTACTGTACTTTCTATATAAGCAAAAATGCTAAACGACAAACTTGAAAT

Full Affymetrix probeset data:

Annotations for 1628729_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime