Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628730_at:

>probe:Drosophila_2:1628730_at:61:637; Interrogation_Position=139; Antisense; TCGAATTAACCGTACAGAGCAGCAG
>probe:Drosophila_2:1628730_at:625:111; Interrogation_Position=156; Antisense; AGCAGCAGGTATCTCTTTGTTTTTT
>probe:Drosophila_2:1628730_at:73:257; Interrogation_Position=237; Antisense; CAAATCGTTGAAATGCCGGAGCGCA
>probe:Drosophila_2:1628730_at:141:235; Interrogation_Position=248; Antisense; AATGCCGGAGCGCAGCATCAGTCAG
>probe:Drosophila_2:1628730_at:340:267; Interrogation_Position=266; Antisense; CAGTCAGCGGGATCTCGACGAGATT
>probe:Drosophila_2:1628730_at:18:343; Interrogation_Position=34; Antisense; GCTTTCATCGCCAATTGCAGTTTCG
>probe:Drosophila_2:1628730_at:173:413; Interrogation_Position=350; Antisense; GAGTCGCCGTAATCGACGCGGTGCC
>probe:Drosophila_2:1628730_at:673:43; Interrogation_Position=392; Antisense; ATCGCGTGCTCGCAATGCCACCAAT
>probe:Drosophila_2:1628730_at:147:253; Interrogation_Position=410; Antisense; CACCAATGGCATTCAAAATCGCGGA
>probe:Drosophila_2:1628730_at:601:245; Interrogation_Position=46; Antisense; AATTGCAGTTTCGAGTGCGTTCGGT
>probe:Drosophila_2:1628730_at:485:657; Interrogation_Position=470; Antisense; TAGGGAGCGTTTTGGTGGCACCAAT
>probe:Drosophila_2:1628730_at:660:377; Interrogation_Position=504; Antisense; GAAGCTCGCTTCTATGACGATGAGG
>probe:Drosophila_2:1628730_at:435:507; Interrogation_Position=60; Antisense; GTGCGTTCGGTGCAAGTCTAACTCT
>probe:Drosophila_2:1628730_at:77:499; Interrogation_Position=75; Antisense; GTCTAACTCTTGGTTGGCCAAACAA

Paste this into a BLAST search page for me
TCGAATTAACCGTACAGAGCAGCAGAGCAGCAGGTATCTCTTTGTTTTTTCAAATCGTTGAAATGCCGGAGCGCAAATGCCGGAGCGCAGCATCAGTCAGCAGTCAGCGGGATCTCGACGAGATTGCTTTCATCGCCAATTGCAGTTTCGGAGTCGCCGTAATCGACGCGGTGCCATCGCGTGCTCGCAATGCCACCAATCACCAATGGCATTCAAAATCGCGGAAATTGCAGTTTCGAGTGCGTTCGGTTAGGGAGCGTTTTGGTGGCACCAATGAAGCTCGCTTCTATGACGATGAGGGTGCGTTCGGTGCAAGTCTAACTCTGTCTAACTCTTGGTTGGCCAAACAA

Full Affymetrix probeset data:

Annotations for 1628730_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime