Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628732_at:

>probe:Drosophila_2:1628732_at:152:121; Interrogation_Position=2002; Antisense; AGCGTTGCCCAAACCGAGTACATGA
>probe:Drosophila_2:1628732_at:91:305; Interrogation_Position=2015; Antisense; CCGAGTACATGACCATCGAGCAGCT
>probe:Drosophila_2:1628732_at:529:377; Interrogation_Position=2052; Antisense; GAAGCACTCACTGCGGAACAGCATT
>probe:Drosophila_2:1628732_at:457:561; Interrogation_Position=2066; Antisense; GGAACAGCATTAGGCGGTCCACGCG
>probe:Drosophila_2:1628732_at:640:469; Interrogation_Position=2109; Antisense; GTTCCACAAGAGTCACGATGCCTAT
>probe:Drosophila_2:1628732_at:583:447; Interrogation_Position=2125; Antisense; GATGCCTATGCAACCGCCAAGTGAG
>probe:Drosophila_2:1628732_at:567:349; Interrogation_Position=2149; Antisense; GCAGGTTGGCTCCACAGATTCAATT
>probe:Drosophila_2:1628732_at:505:459; Interrogation_Position=2165; Antisense; GATTCAATTGGTGCGTCGATTTTTA
>probe:Drosophila_2:1628732_at:496:711; Interrogation_Position=2196; Antisense; TTCAAATGGCATTTCTGTAACCGAA
>probe:Drosophila_2:1628732_at:156:51; Interrogation_Position=2253; Antisense; ATGCGCCTTCCCCTTGTTGAATTGA
>probe:Drosophila_2:1628732_at:336:361; Interrogation_Position=2271; Antisense; GAATTGACCCAATTGACTTCTTTTC
>probe:Drosophila_2:1628732_at:194:653; Interrogation_Position=2294; Antisense; TCAATTCGATTTTTCAGCACCTAGT
>probe:Drosophila_2:1628732_at:509:215; Interrogation_Position=2339; Antisense; AAGATTGTCACACAAGACCAGCGAA
>probe:Drosophila_2:1628732_at:309:217; Interrogation_Position=2485; Antisense; AAGTTACTTGATGTTTGCACGTTTA

Paste this into a BLAST search page for me
AGCGTTGCCCAAACCGAGTACATGACCGAGTACATGACCATCGAGCAGCTGAAGCACTCACTGCGGAACAGCATTGGAACAGCATTAGGCGGTCCACGCGGTTCCACAAGAGTCACGATGCCTATGATGCCTATGCAACCGCCAAGTGAGGCAGGTTGGCTCCACAGATTCAATTGATTCAATTGGTGCGTCGATTTTTATTCAAATGGCATTTCTGTAACCGAAATGCGCCTTCCCCTTGTTGAATTGAGAATTGACCCAATTGACTTCTTTTCTCAATTCGATTTTTCAGCACCTAGTAAGATTGTCACACAAGACCAGCGAAAAGTTACTTGATGTTTGCACGTTTA

Full Affymetrix probeset data:

Annotations for 1628732_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime