FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628733_at:

>probe:Drosophila_2:1628733_at:695:685; Interrogation_Position=3525; Antisense; TATTTTACTACATCGCTACACCTTG
>probe:Drosophila_2:1628733_at:540:155; Interrogation_Position=3542; Antisense; ACACCTTGGTGCGAATCCACGTCAA
>probe:Drosophila_2:1628733_at:689:593; Interrogation_Position=3569; Antisense; TGGGCAATCATTTGCTGGCCGCTAA
>probe:Drosophila_2:1628733_at:95:275; Interrogation_Position=3598; Antisense; CTTGTCCAAGTAGCCGCCTGTATAT
>probe:Drosophila_2:1628733_at:277:601; Interrogation_Position=3616; Antisense; TGTATATCCCAGTTTCCCGAACATA
>probe:Drosophila_2:1628733_at:326:281; Interrogation_Position=3714; Antisense; CTCCACATTGATGCGTCCGGATTAT
>probe:Drosophila_2:1628733_at:263:357; Interrogation_Position=3741; Antisense; GAATCAATTGGATCCCCGGTATGCA
>probe:Drosophila_2:1628733_at:8:697; Interrogation_Position=3782; Antisense; TTGTCCGCAAGGCTCCCAAGGGTAT
>probe:Drosophila_2:1628733_at:247:589; Interrogation_Position=3842; Antisense; TGGAGTGTCCCATTTGCGACTCGAA
>probe:Drosophila_2:1628733_at:558:323; Interrogation_Position=3857; Antisense; GCGACTCGAACCTGGCCAATATGGA
>probe:Drosophila_2:1628733_at:542:435; Interrogation_Position=3880; Antisense; GAGGTGACCTGCTATAGCTGCAAGA
>probe:Drosophila_2:1628733_at:349:607; Interrogation_Position=3953; Antisense; TGATGACCTCATGTCCACAGTGCGA
>probe:Drosophila_2:1628733_at:591:403; Interrogation_Position=3976; Antisense; GACTTTCTTTGCTTTCGCGCAGAGA
>probe:Drosophila_2:1628733_at:636:99; Interrogation_Position=4026; Antisense; AGAGTGTCCCATGTGTGGCGAGAAT

Paste this into a BLAST search page for me
TATTTTACTACATCGCTACACCTTGACACCTTGGTGCGAATCCACGTCAATGGGCAATCATTTGCTGGCCGCTAACTTGTCCAAGTAGCCGCCTGTATATTGTATATCCCAGTTTCCCGAACATACTCCACATTGATGCGTCCGGATTATGAATCAATTGGATCCCCGGTATGCATTGTCCGCAAGGCTCCCAAGGGTATTGGAGTGTCCCATTTGCGACTCGAAGCGACTCGAACCTGGCCAATATGGAGAGGTGACCTGCTATAGCTGCAAGATGATGACCTCATGTCCACAGTGCGAGACTTTCTTTGCTTTCGCGCAGAGAAGAGTGTCCCATGTGTGGCGAGAAT

Full Affymetrix probeset data:

Annotations for 1628733_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720