FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628734_at:

>probe:Drosophila_2:1628734_at:397:661; Interrogation_Position=122; Antisense; TAAAAATGTACCAGTTCACCGCCTC
>probe:Drosophila_2:1628734_at:359:133; Interrogation_Position=148; Antisense; ACGCGAAGTTTGTGGCCAAGGCCCA
>probe:Drosophila_2:1628734_at:262:257; Interrogation_Position=218; Antisense; CACTTCGTTGGTTTCCTTGTCAGGA
>probe:Drosophila_2:1628734_at:637:647; Interrogation_Position=237; Antisense; TCAGGACTTGCTTCCCGATATGAGT
>probe:Drosophila_2:1628734_at:205:23; Interrogation_Position=254; Antisense; ATATGAGTTCCATCGTCTCCAGGAG
>probe:Drosophila_2:1628734_at:38:93; Interrogation_Position=330; Antisense; AGTTTGCATCCCAGCTACGATATAA
>probe:Drosophila_2:1628734_at:384:489; Interrogation_Position=365; Antisense; GTACGATCTTAATTGCTATGTGCGG
>probe:Drosophila_2:1628734_at:40:279; Interrogation_Position=380; Antisense; CTATGTGCGGTATCTGGACTCCAAA
>probe:Drosophila_2:1628734_at:624:451; Interrogation_Position=414; Antisense; GATAGGCAGTTCCTTCACGAAATGG
>probe:Drosophila_2:1628734_at:16:41; Interrogation_Position=465; Antisense; ATCTGCGACCAGTTTTTCCTGAAGA
>probe:Drosophila_2:1628734_at:48:163; Interrogation_Position=49; Antisense; AAATTTTCAACATGTCCGCGACGAG
>probe:Drosophila_2:1628734_at:116:185; Interrogation_Position=557; Antisense; AAAATTCTTTCAACTGCCTCCTAAG
>probe:Drosophila_2:1628734_at:455:139; Interrogation_Position=587; Antisense; ACGTCGCGTCGAGTATCTGTTGAAA
>probe:Drosophila_2:1628734_at:234:701; Interrogation_Position=76; Antisense; TTGTAACCATTAAGTCGATCCCCTC

Paste this into a BLAST search page for me
TAAAAATGTACCAGTTCACCGCCTCACGCGAAGTTTGTGGCCAAGGCCCACACTTCGTTGGTTTCCTTGTCAGGATCAGGACTTGCTTCCCGATATGAGTATATGAGTTCCATCGTCTCCAGGAGAGTTTGCATCCCAGCTACGATATAAGTACGATCTTAATTGCTATGTGCGGCTATGTGCGGTATCTGGACTCCAAAGATAGGCAGTTCCTTCACGAAATGGATCTGCGACCAGTTTTTCCTGAAGAAAATTTTCAACATGTCCGCGACGAGAAAATTCTTTCAACTGCCTCCTAAGACGTCGCGTCGAGTATCTGTTGAAATTGTAACCATTAAGTCGATCCCCTC

Full Affymetrix probeset data:

Annotations for 1628734_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720