FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628736_at:

>probe:Drosophila_2:1628736_at:1:165; Interrogation_Position=1000; Antisense; AAATACGATCACAGCATTGGCGAAA
>probe:Drosophila_2:1628736_at:392:451; Interrogation_Position=1029; Antisense; GATCGAGAACATGGAGCTCGCCGAA
>probe:Drosophila_2:1628736_at:420:553; Interrogation_Position=1041; Antisense; GGAGCTCGCCGAAGAACACAAAAAG
>probe:Drosophila_2:1628736_at:420:107; Interrogation_Position=1070; Antisense; AGAAGGCCCTCGACGAATACATGAT
>probe:Drosophila_2:1628736_at:141:365; Interrogation_Position=1084; Antisense; GAATACATGATTGGGTTCCTGAAGG
>probe:Drosophila_2:1628736_at:255:471; Interrogation_Position=1098; Antisense; GTTCCTGAAGGTTGAGCGGGTCTAC
>probe:Drosophila_2:1628736_at:574:467; Interrogation_Position=1108; Antisense; GTTGAGCGGGTCTACAAGCAGATCG
>probe:Drosophila_2:1628736_at:237:43; Interrogation_Position=1172; Antisense; ATCGTGTCCTGTTATTCGCCATGAA
>probe:Drosophila_2:1628736_at:550:601; Interrogation_Position=1181; Antisense; TGTTATTCGCCATGAACCGCGCAGC
>probe:Drosophila_2:1628736_at:228:299; Interrogation_Position=1198; Antisense; CGCGCAGCCATCAAGATCCAGAAAT
>probe:Drosophila_2:1628736_at:541:383; Interrogation_Position=1272; Antisense; GAACTGAAACCATTTTGAATAGCCA
>probe:Drosophila_2:1628736_at:71:395; Interrogation_Position=808; Antisense; GAAATCGATCGGTGCACTCGTCTGG
>probe:Drosophila_2:1628736_at:486:417; Interrogation_Position=859; Antisense; GAGCGACAAGCTGATTTGGAAGAAC
>probe:Drosophila_2:1628736_at:580:707; Interrogation_Position=976; Antisense; TTACAACTACAAGCCATTATCAAGA

Paste this into a BLAST search page for me
AAATACGATCACAGCATTGGCGAAAGATCGAGAACATGGAGCTCGCCGAAGGAGCTCGCCGAAGAACACAAAAAGAGAAGGCCCTCGACGAATACATGATGAATACATGATTGGGTTCCTGAAGGGTTCCTGAAGGTTGAGCGGGTCTACGTTGAGCGGGTCTACAAGCAGATCGATCGTGTCCTGTTATTCGCCATGAATGTTATTCGCCATGAACCGCGCAGCCGCGCAGCCATCAAGATCCAGAAATGAACTGAAACCATTTTGAATAGCCAGAAATCGATCGGTGCACTCGTCTGGGAGCGACAAGCTGATTTGGAAGAACTTACAACTACAAGCCATTATCAAGA

Full Affymetrix probeset data:

Annotations for 1628736_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720