FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628737_at:

>probe:Drosophila_2:1628737_at:179:399; Interrogation_Position=106; Antisense; GACACTACCGAATGCTGCAGCGCAG
>probe:Drosophila_2:1628737_at:88:723; Interrogation_Position=133; Antisense; TTGCAGCCATCCAGCGGCGACGCGT
>probe:Drosophila_2:1628737_at:309:295; Interrogation_Position=150; Antisense; CGACGCGTTGCATGTGCAGCAGCAA
>probe:Drosophila_2:1628737_at:352:293; Interrogation_Position=254; Antisense; CGAAAACGAGGATGACAACGACCAC
>probe:Drosophila_2:1628737_at:171:397; Interrogation_Position=267; Antisense; GACAACGACCACAGGCAAACGCGGA
>probe:Drosophila_2:1628737_at:563:267; Interrogation_Position=278; Antisense; CAGGCAAACGCGGAGGACACAGATA
>probe:Drosophila_2:1628737_at:186:559; Interrogation_Position=292; Antisense; GGACACAGATACAGAAGCAGGCTCA
>probe:Drosophila_2:1628737_at:310:109; Interrogation_Position=304; Antisense; AGAAGCAGGCTCAGTCACCGAAGCA
>probe:Drosophila_2:1628737_at:283:89; Interrogation_Position=316; Antisense; AGTCACCGAAGCACAGCAACAATTG
>probe:Drosophila_2:1628737_at:185:153; Interrogation_Position=46; Antisense; ACATCCAGATCCAGAGGCACACTTC
>probe:Drosophila_2:1628737_at:107:73; Interrogation_Position=60; Antisense; AGGCACACTTCCAACTGTTTTGACG
>probe:Drosophila_2:1628737_at:370:601; Interrogation_Position=75; Antisense; TGTTTTGACGTGGTCGGGTTCCAAT
>probe:Drosophila_2:1628737_at:74:591; Interrogation_Position=85; Antisense; TGGTCGGGTTCCAATGGCGCTGACA
>probe:Drosophila_2:1628737_at:97:229; Interrogation_Position=97; Antisense; AATGGCGCTGACACTACCGAATGCT

Paste this into a BLAST search page for me
GACACTACCGAATGCTGCAGCGCAGTTGCAGCCATCCAGCGGCGACGCGTCGACGCGTTGCATGTGCAGCAGCAACGAAAACGAGGATGACAACGACCACGACAACGACCACAGGCAAACGCGGACAGGCAAACGCGGAGGACACAGATAGGACACAGATACAGAAGCAGGCTCAAGAAGCAGGCTCAGTCACCGAAGCAAGTCACCGAAGCACAGCAACAATTGACATCCAGATCCAGAGGCACACTTCAGGCACACTTCCAACTGTTTTGACGTGTTTTGACGTGGTCGGGTTCCAATTGGTCGGGTTCCAATGGCGCTGACAAATGGCGCTGACACTACCGAATGCT

Full Affymetrix probeset data:

Annotations for 1628737_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720