FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628738_at:

>probe:Drosophila_2:1628738_at:353:63; Interrogation_Position=476; Antisense; ATGTGTTCGAAACGCACTGCTGGTC
>probe:Drosophila_2:1628738_at:401:333; Interrogation_Position=494; Antisense; GCTGGTCACAAACCCTCAAGGATGT
>probe:Drosophila_2:1628738_at:71:339; Interrogation_Position=529; Antisense; GCTCTGCTTCCCAAGGATCATCAAA
>probe:Drosophila_2:1628738_at:262:335; Interrogation_Position=564; Antisense; GCTGCACATTTCAATTCAGGCCCAG
>probe:Drosophila_2:1628738_at:238:361; Interrogation_Position=605; Antisense; GCAAGCATAGCCCAGAGACGATCAT
>probe:Drosophila_2:1628738_at:522:407; Interrogation_Position=621; Antisense; GACGATCATCCTCGAGGGAAACCTG
>probe:Drosophila_2:1628738_at:451:335; Interrogation_Position=726; Antisense; GCTCTGGTGGGATCGGCTCTTCGAA
>probe:Drosophila_2:1628738_at:237:561; Interrogation_Position=813; Antisense; GGAAACCCAGGCCACCATAGAAAAG
>probe:Drosophila_2:1628738_at:327:343; Interrogation_Position=837; Antisense; GCTTAGGGTCCAGCAGTTGGCAGCA
>probe:Drosophila_2:1628738_at:83:611; Interrogation_Position=876; Antisense; TGAAATTCAGACCTCAAGTCCCGAC
>probe:Drosophila_2:1628738_at:11:219; Interrogation_Position=891; Antisense; AAGTCCCGACCAAGCTATAAACCTG
>probe:Drosophila_2:1628738_at:446:587; Interrogation_Position=914; Antisense; TGGATCGCCTGAAAGCTGCCTGGGA
>probe:Drosophila_2:1628738_at:38:447; Interrogation_Position=937; Antisense; GATGCCGAAGGTTCGCCGTTTAAAG
>probe:Drosophila_2:1628738_at:368:321; Interrogation_Position=966; Antisense; GCCCTTTGATCCTTCTATCGTAAGA

Paste this into a BLAST search page for me
ATGTGTTCGAAACGCACTGCTGGTCGCTGGTCACAAACCCTCAAGGATGTGCTCTGCTTCCCAAGGATCATCAAAGCTGCACATTTCAATTCAGGCCCAGGCAAGCATAGCCCAGAGACGATCATGACGATCATCCTCGAGGGAAACCTGGCTCTGGTGGGATCGGCTCTTCGAAGGAAACCCAGGCCACCATAGAAAAGGCTTAGGGTCCAGCAGTTGGCAGCATGAAATTCAGACCTCAAGTCCCGACAAGTCCCGACCAAGCTATAAACCTGTGGATCGCCTGAAAGCTGCCTGGGAGATGCCGAAGGTTCGCCGTTTAAAGGCCCTTTGATCCTTCTATCGTAAGA

Full Affymetrix probeset data:

Annotations for 1628738_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720