Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628739_at:

>probe:Drosophila_2:1628739_at:473:109; Interrogation_Position=1322; Antisense; AGAAGAAGGTACGTATGGCCAGAGA
>probe:Drosophila_2:1628739_at:514:265; Interrogation_Position=1341; Antisense; CAGAGAGGCGGCTGAGGCTGCTGCA
>probe:Drosophila_2:1628739_at:163:527; Interrogation_Position=1385; Antisense; GGGAATTCTCTGGAATACCCCAGAT
>probe:Drosophila_2:1628739_at:109:363; Interrogation_Position=1397; Antisense; GAATACCCCAGATGACCGCATCCTG
>probe:Drosophila_2:1628739_at:109:625; Interrogation_Position=1420; Antisense; TGCCCGGCCATCATGCATGGTGCAT
>probe:Drosophila_2:1628739_at:31:53; Interrogation_Position=1432; Antisense; ATGCATGGTGCATCTGTTCCCGATT
>probe:Drosophila_2:1628739_at:211:535; Interrogation_Position=1438; Antisense; GGTGCATCTGTTCCCGATTCGGATG
>probe:Drosophila_2:1628739_at:728:671; Interrogation_Position=1489; Antisense; TACGAGAGCGAGAGGCTTTGAGTCT
>probe:Drosophila_2:1628739_at:114:341; Interrogation_Position=1503; Antisense; GCTTTGAGTCTCGATACATTGCTTA
>probe:Drosophila_2:1628739_at:319:431; Interrogation_Position=1508; Antisense; GAGTCTCGATACATTGCTTAATTTT
>probe:Drosophila_2:1628739_at:152:15; Interrogation_Position=1541; Antisense; ATTATTTTTCGTATACTTAGTCATT
>probe:Drosophila_2:1628739_at:217:497; Interrogation_Position=1560; Antisense; GTCATTATCATTGTTTTTAGCCCTA
>probe:Drosophila_2:1628739_at:555:701; Interrogation_Position=1564; Antisense; TTATCATTGTTTTTAGCCCTAAGTT
>probe:Drosophila_2:1628739_at:513:655; Interrogation_Position=1583; Antisense; TAAGTTCAGCTTAATTTGTTTGTAA

Paste this into a BLAST search page for me
AGAAGAAGGTACGTATGGCCAGAGACAGAGAGGCGGCTGAGGCTGCTGCAGGGAATTCTCTGGAATACCCCAGATGAATACCCCAGATGACCGCATCCTGTGCCCGGCCATCATGCATGGTGCATATGCATGGTGCATCTGTTCCCGATTGGTGCATCTGTTCCCGATTCGGATGTACGAGAGCGAGAGGCTTTGAGTCTGCTTTGAGTCTCGATACATTGCTTAGAGTCTCGATACATTGCTTAATTTTATTATTTTTCGTATACTTAGTCATTGTCATTATCATTGTTTTTAGCCCTATTATCATTGTTTTTAGCCCTAAGTTTAAGTTCAGCTTAATTTGTTTGTAA

Full Affymetrix probeset data:

Annotations for 1628739_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime