Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628741_s_at:

>probe:Drosophila_2:1628741_s_at:128:359; Interrogation_Position=105; Antisense; GCAACACTTCCCGTATGAATTGGTA
>probe:Drosophila_2:1628741_s_at:92:249; Interrogation_Position=109; Antisense; CACTTCCCGTATGAATTGGTAAAGA
>probe:Drosophila_2:1628741_s_at:397:59; Interrogation_Position=13; Antisense; ATGTACGACACACCGCCGGTGAGTG
>probe:Drosophila_2:1628741_s_at:690:381; Interrogation_Position=132; Antisense; GAACGAGGACGAATGGGATGCAATT
>probe:Drosophila_2:1628741_s_at:288:327; Interrogation_Position=161; Antisense; GCGATGTGTACGAGAGGCCAGAATA
>probe:Drosophila_2:1628741_s_at:301:157; Interrogation_Position=22; Antisense; ACACCGCCGGTGAGTGCTTGGAGAA
>probe:Drosophila_2:1628741_s_at:686:221; Interrogation_Position=55; Antisense; AAGGGTCGAGTGATGTCCAACGTCA
>probe:Drosophila_2:1628741_s_at:175:501; Interrogation_Position=59; Antisense; GTCGAGTGATGTCCAACGTCAGCAT
>probe:Drosophila_2:1628741_s_at:539:433; Interrogation_Position=62; Antisense; GAGTGATGTCCAACGTCAGCATGAC
>probe:Drosophila_2:1628741_s_at:72:599; Interrogation_Position=68; Antisense; TGTCCAACGTCAGCATGACACTCTA
>probe:Drosophila_2:1628741_s_at:271:139; Interrogation_Position=74; Antisense; ACGTCAGCATGACACTCTACTGGTG
>probe:Drosophila_2:1628741_s_at:35:649; Interrogation_Position=77; Antisense; TCAGCATGACACTCTACTGGTGGAT
>probe:Drosophila_2:1628741_s_at:490:669; Interrogation_Position=91; Antisense; TACTGGTGGATCCAGCAACACTTCC
>probe:Drosophila_2:1628741_s_at:206:449; Interrogation_Position=99; Antisense; GATCCAGCAACACTTCCCGTATGAA

Paste this into a BLAST search page for me
GCAACACTTCCCGTATGAATTGGTACACTTCCCGTATGAATTGGTAAAGAATGTACGACACACCGCCGGTGAGTGGAACGAGGACGAATGGGATGCAATTGCGATGTGTACGAGAGGCCAGAATAACACCGCCGGTGAGTGCTTGGAGAAAAGGGTCGAGTGATGTCCAACGTCAGTCGAGTGATGTCCAACGTCAGCATGAGTGATGTCCAACGTCAGCATGACTGTCCAACGTCAGCATGACACTCTAACGTCAGCATGACACTCTACTGGTGTCAGCATGACACTCTACTGGTGGATTACTGGTGGATCCAGCAACACTTCCGATCCAGCAACACTTCCCGTATGAA

Full Affymetrix probeset data:

Annotations for 1628741_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime