FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628743_at:

>probe:Drosophila_2:1628743_at:25:161; Interrogation_Position=1293; Antisense; AACCCCAGAAAAGATCGGCGCGCGT
>probe:Drosophila_2:1628743_at:414:41; Interrogation_Position=1306; Antisense; ATCGGCGCGCGTGCACGGCCAAAAA
>probe:Drosophila_2:1628743_at:589:493; Interrogation_Position=1367; Antisense; GTAATATATCCGGATGCATTGCGAT
>probe:Drosophila_2:1628743_at:391:445; Interrogation_Position=1379; Antisense; GATGCATTGCGATATCGGTCTTATA
>probe:Drosophila_2:1628743_at:404:705; Interrogation_Position=1439; Antisense; TTAGACAAGCGATCGACAGCGCCAT
>probe:Drosophila_2:1628743_at:398:123; Interrogation_Position=1456; Antisense; AGCGCCATGCATCCACTATATATAG
>probe:Drosophila_2:1628743_at:317:175; Interrogation_Position=1496; Antisense; AAACCAATTCAAGCGTTCTCAGCGT
>probe:Drosophila_2:1628743_at:11:711; Interrogation_Position=1511; Antisense; TTCTCAGCGTGTTTTCGGGTCCAGA
>probe:Drosophila_2:1628743_at:255:701; Interrogation_Position=1522; Antisense; TTTTCGGGTCCAGATGCACGCGTGT
>probe:Drosophila_2:1628743_at:158:355; Interrogation_Position=1537; Antisense; GCACGCGTGTGCCAAAAGTATTTAC
>probe:Drosophila_2:1628743_at:248:249; Interrogation_Position=1561; Antisense; CAATTTACTTTGTGTCATGATCTCA
>probe:Drosophila_2:1628743_at:328:703; Interrogation_Position=1651; Antisense; TTCTTCTTAGCCCACAAACAAACAC
>probe:Drosophila_2:1628743_at:682:257; Interrogation_Position=1741; Antisense; CACACACTGTACTCATATTTATTGT
>probe:Drosophila_2:1628743_at:90:181; Interrogation_Position=1815; Antisense; AAAAACTTCGTATCTATGGCAAAAT

Paste this into a BLAST search page for me
AACCCCAGAAAAGATCGGCGCGCGTATCGGCGCGCGTGCACGGCCAAAAAGTAATATATCCGGATGCATTGCGATGATGCATTGCGATATCGGTCTTATATTAGACAAGCGATCGACAGCGCCATAGCGCCATGCATCCACTATATATAGAAACCAATTCAAGCGTTCTCAGCGTTTCTCAGCGTGTTTTCGGGTCCAGATTTTCGGGTCCAGATGCACGCGTGTGCACGCGTGTGCCAAAAGTATTTACCAATTTACTTTGTGTCATGATCTCATTCTTCTTAGCCCACAAACAAACACCACACACTGTACTCATATTTATTGTAAAAACTTCGTATCTATGGCAAAAT

Full Affymetrix probeset data:

Annotations for 1628743_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720