FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628745_at:

>probe:Drosophila_2:1628745_at:182:75; Interrogation_Position=311; Antisense; AGGTTGTGGTAGTCATGCCCAAGGT
>probe:Drosophila_2:1628745_at:624:591; Interrogation_Position=315; Antisense; TGTGGTAGTCATGCCCAAGGTTCAG
>probe:Drosophila_2:1628745_at:382:223; Interrogation_Position=331; Antisense; AAGGTTCAGGGCATCTCTGCCAATG
>probe:Drosophila_2:1628745_at:225:525; Interrogation_Position=339; Antisense; GGGCATCTCTGCCAATGGTTTGTTA
>probe:Drosophila_2:1628745_at:10:283; Interrogation_Position=347; Antisense; CTGCCAATGGTTTGTTAGTTGTTAA
>probe:Drosophila_2:1628745_at:364:603; Interrogation_Position=366; Antisense; TGTTAATGGCGATTTCGTGCGCAAA
>probe:Drosophila_2:1628745_at:378:223; Interrogation_Position=414; Antisense; AATGGCCAAAGCAGCCAAGGCACCC
>probe:Drosophila_2:1628745_at:106:175; Interrogation_Position=543; Antisense; AAAGCCAGAATCAGAGGAAACCATT
>probe:Drosophila_2:1628745_at:672:423; Interrogation_Position=556; Antisense; GAGGAAACCATTAAGGTGGTGGCCA
>probe:Drosophila_2:1628745_at:395:371; Interrogation_Position=624; Antisense; GAAGGTCCAAATGATGCTCTCTAAA
>probe:Drosophila_2:1628745_at:180:447; Interrogation_Position=636; Antisense; GATGCTCTCTAAAAACAATGAGGAA
>probe:Drosophila_2:1628745_at:228:707; Interrogation_Position=870; Antisense; TTACCTATCTTTCTACTCCGATGGC
>probe:Drosophila_2:1628745_at:663:685; Interrogation_Position=875; Antisense; TATCTTTCTACTCCGATGGCTATGA
>probe:Drosophila_2:1628745_at:322:279; Interrogation_Position=882; Antisense; CTACTCCGATGGCTATGATTCCTAG

Paste this into a BLAST search page for me
AGGTTGTGGTAGTCATGCCCAAGGTTGTGGTAGTCATGCCCAAGGTTCAGAAGGTTCAGGGCATCTCTGCCAATGGGGCATCTCTGCCAATGGTTTGTTACTGCCAATGGTTTGTTAGTTGTTAATGTTAATGGCGATTTCGTGCGCAAAAATGGCCAAAGCAGCCAAGGCACCCAAAGCCAGAATCAGAGGAAACCATTGAGGAAACCATTAAGGTGGTGGCCAGAAGGTCCAAATGATGCTCTCTAAAGATGCTCTCTAAAAACAATGAGGAATTACCTATCTTTCTACTCCGATGGCTATCTTTCTACTCCGATGGCTATGACTACTCCGATGGCTATGATTCCTAG

Full Affymetrix probeset data:

Annotations for 1628745_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720