FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628746_at:

>probe:Drosophila_2:1628746_at:559:263; Interrogation_Position=1896; Antisense; CATGACGAATCAGGGTGGCACGGGC
>probe:Drosophila_2:1628746_at:531:237; Interrogation_Position=1903; Antisense; AATCAGGGTGGCACGGGCATCGTTG
>probe:Drosophila_2:1628746_at:451:257; Interrogation_Position=1914; Antisense; CACGGGCATCGTTGGCAGTGGGTCG
>probe:Drosophila_2:1628746_at:430:265; Interrogation_Position=1929; Antisense; CAGTGGGTCGGCTGGCATTGCCCAC
>probe:Drosophila_2:1628746_at:301:531; Interrogation_Position=1933; Antisense; GGGTCGGCTGGCATTGCCCACTTGA
>probe:Drosophila_2:1628746_at:695:583; Interrogation_Position=1941; Antisense; TGGCATTGCCCACTTGACATCAGGT
>probe:Drosophila_2:1628746_at:373:345; Interrogation_Position=1943; Antisense; GCATTGCCCACTTGACATCAGGTGG
>probe:Drosophila_2:1628746_at:554:719; Interrogation_Position=1946; Antisense; TTGCCCACTTGACATCAGGTGGTTC
>probe:Drosophila_2:1628746_at:208:149; Interrogation_Position=1957; Antisense; ACATCAGGTGGTTCCCATCGACCCA
>probe:Drosophila_2:1628746_at:514:79; Interrogation_Position=1962; Antisense; AGGTGGTTCCCATCGACCCAGTCTG
>probe:Drosophila_2:1628746_at:80:271; Interrogation_Position=1972; Antisense; CATCGACCCAGTCTGATCAGGATCA
>probe:Drosophila_2:1628746_at:328:637; Interrogation_Position=1974; Antisense; TCGACCCAGTCTGATCAGGATCAAT
>probe:Drosophila_2:1628746_at:26:413; Interrogation_Position=1976; Antisense; GACCCAGTCTGATCAGGATCAATCA
>probe:Drosophila_2:1628746_at:506:87; Interrogation_Position=1981; Antisense; AGTCTGATCAGGATCAATCAGCTGC

Paste this into a BLAST search page for me
CATGACGAATCAGGGTGGCACGGGCAATCAGGGTGGCACGGGCATCGTTGCACGGGCATCGTTGGCAGTGGGTCGCAGTGGGTCGGCTGGCATTGCCCACGGGTCGGCTGGCATTGCCCACTTGATGGCATTGCCCACTTGACATCAGGTGCATTGCCCACTTGACATCAGGTGGTTGCCCACTTGACATCAGGTGGTTCACATCAGGTGGTTCCCATCGACCCAAGGTGGTTCCCATCGACCCAGTCTGCATCGACCCAGTCTGATCAGGATCATCGACCCAGTCTGATCAGGATCAATGACCCAGTCTGATCAGGATCAATCAAGTCTGATCAGGATCAATCAGCTGC

Full Affymetrix probeset data:

Annotations for 1628746_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720