Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628749_at:

>probe:Drosophila_2:1628749_at:481:695; Interrogation_Position=1016; Antisense; TTTCCCGTCTCGAAATGGTGGTCAA
>probe:Drosophila_2:1628749_at:517:653; Interrogation_Position=1037; Antisense; TCAATGGCAGGAGTGTCTTCGGCCT
>probe:Drosophila_2:1628749_at:130:587; Interrogation_Position=1061; Antisense; TGGACTCAGAGATACCCGACATACG
>probe:Drosophila_2:1628749_at:115:147; Interrogation_Position=1107; Antisense; ACAAAACAACATGGTTTCCGCCCAG
>probe:Drosophila_2:1628749_at:575:589; Interrogation_Position=1143; Antisense; TGGTACCGCCACCTCCAGGATTAGA
>probe:Drosophila_2:1628749_at:12:77; Interrogation_Position=1278; Antisense; AGGAGACGCCGATGGCACCCAGCTA
>probe:Drosophila_2:1628749_at:112:197; Interrogation_Position=1312; Antisense; AACGGACCCGGCAGCAGTATGCTCA
>probe:Drosophila_2:1628749_at:60:485; Interrogation_Position=1328; Antisense; GTATGCTCAACTCCCGGGACGAAGA
>probe:Drosophila_2:1628749_at:306:291; Interrogation_Position=1362; Antisense; CGGGAGCTCCGAAAGCGAACTGGAT
>probe:Drosophila_2:1628749_at:724:57; Interrogation_Position=1423; Antisense; ATGAGTGGCATGAGCGCTATCAGCG
>probe:Drosophila_2:1628749_at:255:249; Interrogation_Position=1464; Antisense; CAATATTGCCTTGGGAGCCGGCGAT
>probe:Drosophila_2:1628749_at:515:573; Interrogation_Position=1540; Antisense; GGCGAACTGCCACTTAGACCGAAGA
>probe:Drosophila_2:1628749_at:107:705; Interrogation_Position=1553; Antisense; TTAGACCGAAGACCGCCAATAAAGC
>probe:Drosophila_2:1628749_at:178:241; Interrogation_Position=1570; Antisense; AATAAAGCGGAGCATCACAGCGATG

Paste this into a BLAST search page for me
TTTCCCGTCTCGAAATGGTGGTCAATCAATGGCAGGAGTGTCTTCGGCCTTGGACTCAGAGATACCCGACATACGACAAAACAACATGGTTTCCGCCCAGTGGTACCGCCACCTCCAGGATTAGAAGGAGACGCCGATGGCACCCAGCTAAACGGACCCGGCAGCAGTATGCTCAGTATGCTCAACTCCCGGGACGAAGACGGGAGCTCCGAAAGCGAACTGGATATGAGTGGCATGAGCGCTATCAGCGCAATATTGCCTTGGGAGCCGGCGATGGCGAACTGCCACTTAGACCGAAGATTAGACCGAAGACCGCCAATAAAGCAATAAAGCGGAGCATCACAGCGATG

Full Affymetrix probeset data:

Annotations for 1628749_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime