FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628750_at:

>probe:Drosophila_2:1628750_at:178:429; Interrogation_Position=1045; Antisense; GAGTTTCAGCGGCATCGATTCCTTC
>probe:Drosophila_2:1628750_at:24:409; Interrogation_Position=1075; Antisense; GACGCGGATTTGCATTTGGGATCAT
>probe:Drosophila_2:1628750_at:425:245; Interrogation_Position=576; Antisense; AATTCACATCCATCGGACTTGGGTC
>probe:Drosophila_2:1628750_at:161:727; Interrogation_Position=594; Antisense; TTGGGTCCGGCACTGCGATCACTAT
>probe:Drosophila_2:1628750_at:450:33; Interrogation_Position=611; Antisense; ATCACTATCTCTTCGTCAGCGATGA
>probe:Drosophila_2:1628750_at:136:725; Interrogation_Position=638; Antisense; TTGACAACCACTTGGAACCGGCGGT
>probe:Drosophila_2:1628750_at:341:425; Interrogation_Position=696; Antisense; GAGAGCCTATCTGGAGTACGTTTAT
>probe:Drosophila_2:1628750_at:31:487; Interrogation_Position=775; Antisense; GTAGTCGTAGACAATCTTCGTCACA
>probe:Drosophila_2:1628750_at:123:409; Interrogation_Position=807; Antisense; GACGTATAGTCCCAAAGAGCTCATC
>probe:Drosophila_2:1628750_at:656:357; Interrogation_Position=842; Antisense; GCAAACTGCGAACGACCAATGGTCT
>probe:Drosophila_2:1628750_at:284:311; Interrogation_Position=857; Antisense; CCAATGGTCTGGTCTTTATGCTAGA
>probe:Drosophila_2:1628750_at:593:639; Interrogation_Position=886; Antisense; TCTGGGATTGTCTTCAGTGCAGCTG
>probe:Drosophila_2:1628750_at:568:85; Interrogation_Position=901; Antisense; AGTGCAGCTGCTCTCAAGCGATTTG
>probe:Drosophila_2:1628750_at:128:205; Interrogation_Position=916; Antisense; AAGCGATTTGCACTCACAGCCCTGA

Paste this into a BLAST search page for me
GAGTTTCAGCGGCATCGATTCCTTCGACGCGGATTTGCATTTGGGATCATAATTCACATCCATCGGACTTGGGTCTTGGGTCCGGCACTGCGATCACTATATCACTATCTCTTCGTCAGCGATGATTGACAACCACTTGGAACCGGCGGTGAGAGCCTATCTGGAGTACGTTTATGTAGTCGTAGACAATCTTCGTCACAGACGTATAGTCCCAAAGAGCTCATCGCAAACTGCGAACGACCAATGGTCTCCAATGGTCTGGTCTTTATGCTAGATCTGGGATTGTCTTCAGTGCAGCTGAGTGCAGCTGCTCTCAAGCGATTTGAAGCGATTTGCACTCACAGCCCTGA

Full Affymetrix probeset data:

Annotations for 1628750_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720