Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628751_at:

>probe:Drosophila_2:1628751_at:655:619; Interrogation_Position=1416; Antisense; TGCTAAACCGCTACCACTGGATGTA
>probe:Drosophila_2:1628751_at:576:269; Interrogation_Position=1460; Antisense; CATGCTTACGGCGATTGTGGTCTCT
>probe:Drosophila_2:1628751_at:416:595; Interrogation_Position=1475; Antisense; TGTGGTCTCTTCTGTGTTCACGGTA
>probe:Drosophila_2:1628751_at:275:339; Interrogation_Position=1585; Antisense; GCTAATGCGCTCGAAGATCCAGCTT
>probe:Drosophila_2:1628751_at:368:49; Interrogation_Position=1601; Antisense; ATCCAGCTTCAGTCCATGTTACTAA
>probe:Drosophila_2:1628751_at:75:653; Interrogation_Position=1623; Antisense; TAATGAACCTGGAGTCGAGACCCGT
>probe:Drosophila_2:1628751_at:492:175; Interrogation_Position=1694; Antisense; AAACGACCGCAGCATTTTATCAAGG
>probe:Drosophila_2:1628751_at:619:391; Interrogation_Position=1724; Antisense; GAAAGTGTAACTGCCGCCGATATCC
>probe:Drosophila_2:1628751_at:592:457; Interrogation_Position=1742; Antisense; GATATCCAACGCGTTGCTCAACGTC
>probe:Drosophila_2:1628751_at:568:237; Interrogation_Position=1811; Antisense; AATCTTCCCGAGATGAGCCACATCA
>probe:Drosophila_2:1628751_at:51:645; Interrogation_Position=1845; Antisense; TCAGTGGTTCAGGACGTACCGGGCT
>probe:Drosophila_2:1628751_at:344:509; Interrogation_Position=1871; Antisense; GGACGTAGGCTTTCCTTGTTCAAAT
>probe:Drosophila_2:1628751_at:78:243; Interrogation_Position=1893; Antisense; AATAGCGCTGGGTGTGAGACCGCCT
>probe:Drosophila_2:1628751_at:339:315; Interrogation_Position=1914; Antisense; GCCTCCATTGGATATCATTTCGCTT

Paste this into a BLAST search page for me
TGCTAAACCGCTACCACTGGATGTACATGCTTACGGCGATTGTGGTCTCTTGTGGTCTCTTCTGTGTTCACGGTAGCTAATGCGCTCGAAGATCCAGCTTATCCAGCTTCAGTCCATGTTACTAATAATGAACCTGGAGTCGAGACCCGTAAACGACCGCAGCATTTTATCAAGGGAAAGTGTAACTGCCGCCGATATCCGATATCCAACGCGTTGCTCAACGTCAATCTTCCCGAGATGAGCCACATCATCAGTGGTTCAGGACGTACCGGGCTGGACGTAGGCTTTCCTTGTTCAAATAATAGCGCTGGGTGTGAGACCGCCTGCCTCCATTGGATATCATTTCGCTT

Full Affymetrix probeset data:

Annotations for 1628751_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime