FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628752_at:

>probe:Drosophila_2:1628752_at:120:125; Interrogation_Position=128; Antisense; AGCGCGACAGCGGAATCGTGTGCCT
>probe:Drosophila_2:1628752_at:166:367; Interrogation_Position=140; Antisense; GAATCGTGTGCCTGGGCTGCTACCA
>probe:Drosophila_2:1628752_at:203:555; Interrogation_Position=198; Antisense; GGACCGCTGCGAACTCTGCGATTGG
>probe:Drosophila_2:1628752_at:273:451; Interrogation_Position=233; Antisense; GATCGTGCGCCGACGACGAAGACGT
>probe:Drosophila_2:1628752_at:217:213; Interrogation_Position=251; Antisense; AAGACGTCACGGAGCACCGCGGAGA
>probe:Drosophila_2:1628752_at:630:137; Interrogation_Position=297; Antisense; ACGTGTCACTTTCGCCGGGAATGTG
>probe:Drosophila_2:1628752_at:434:499; Interrogation_Position=334; Antisense; GTCTGCCCGCAGTTGGATTGCATAA
>probe:Drosophila_2:1628752_at:132:21; Interrogation_Position=361; Antisense; ATATTGAGGTTAGTTCGCGGGCGCT
>probe:Drosophila_2:1628752_at:558:441; Interrogation_Position=402; Antisense; GATGGTGCTGGGTACATCCGTACAG
>probe:Drosophila_2:1628752_at:589:379; Interrogation_Position=452; Antisense; GAACCTGGGCGGTCTGTCCGAATAT
>probe:Drosophila_2:1628752_at:384:689; Interrogation_Position=474; Antisense; TATTAGTTTTGGCAGCAGCGGCCCA
>probe:Drosophila_2:1628752_at:200:273; Interrogation_Position=497; Antisense; CATTTCTCGCAGTTCGCAGGCTAGC
>probe:Drosophila_2:1628752_at:495:571; Interrogation_Position=515; Antisense; GGCTAGCCGGCATATACAGATTCTC
>probe:Drosophila_2:1628752_at:693:665; Interrogation_Position=529; Antisense; TACAGATTCTCATGGCGACTCTACG

Paste this into a BLAST search page for me
AGCGCGACAGCGGAATCGTGTGCCTGAATCGTGTGCCTGGGCTGCTACCAGGACCGCTGCGAACTCTGCGATTGGGATCGTGCGCCGACGACGAAGACGTAAGACGTCACGGAGCACCGCGGAGAACGTGTCACTTTCGCCGGGAATGTGGTCTGCCCGCAGTTGGATTGCATAAATATTGAGGTTAGTTCGCGGGCGCTGATGGTGCTGGGTACATCCGTACAGGAACCTGGGCGGTCTGTCCGAATATTATTAGTTTTGGCAGCAGCGGCCCACATTTCTCGCAGTTCGCAGGCTAGCGGCTAGCCGGCATATACAGATTCTCTACAGATTCTCATGGCGACTCTACG

Full Affymetrix probeset data:

Annotations for 1628752_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720