FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628758_at:

>probe:Drosophila_2:1628758_at:421:279; Interrogation_Position=1341; Antisense; CTACGATGATTGCTCCATTTCCGGA
>probe:Drosophila_2:1628758_at:303:369; Interrogation_Position=1372; Antisense; GAATGCGCAGAACACCATCTTTGGG
>probe:Drosophila_2:1628758_at:92:51; Interrogation_Position=1406; Antisense; ATGCGCCAGGCCGTTGAAATCAGCT
>probe:Drosophila_2:1628758_at:75:69; Interrogation_Position=1436; Antisense; ATGGCTAGCATCTATCTGGGCGATC
>probe:Drosophila_2:1628758_at:37:281; Interrogation_Position=1469; Antisense; CTCAGGTGCATCTCGGACATTAGTT
>probe:Drosophila_2:1628758_at:491:557; Interrogation_Position=1483; Antisense; GGACATTAGTTTCATGCACCCGGTG
>probe:Drosophila_2:1628758_at:649:533; Interrogation_Position=1504; Antisense; GGTGCATGTGGATCGGTTCCTCCAG
>probe:Drosophila_2:1628758_at:373:107; Interrogation_Position=1557; Antisense; AGAACTACGTCCAGCTGATGACCGT
>probe:Drosophila_2:1628758_at:593:417; Interrogation_Position=1603; Antisense; GAGCGGCAAAGTGCAGACCACCAAT
>probe:Drosophila_2:1628758_at:557:103; Interrogation_Position=1617; Antisense; AGACCACCAATGTCTTCTACTTGAC
>probe:Drosophila_2:1628758_at:627:639; Interrogation_Position=1632; Antisense; TCTACTTGACCTATCGGGCGGACAA
>probe:Drosophila_2:1628758_at:233:631; Interrogation_Position=1674; Antisense; TCCCGCGATCCTACCGAGAGATGTT
>probe:Drosophila_2:1628758_at:430:485; Interrogation_Position=1713; Antisense; GTAGGCGGAAACTCCTGGGCGCTCT
>probe:Drosophila_2:1628758_at:327:427; Interrogation_Position=1751; Antisense; GAGTACCCCGATCCTATCGAAGTGG

Paste this into a BLAST search page for me
CTACGATGATTGCTCCATTTCCGGAGAATGCGCAGAACACCATCTTTGGGATGCGCCAGGCCGTTGAAATCAGCTATGGCTAGCATCTATCTGGGCGATCCTCAGGTGCATCTCGGACATTAGTTGGACATTAGTTTCATGCACCCGGTGGGTGCATGTGGATCGGTTCCTCCAGAGAACTACGTCCAGCTGATGACCGTGAGCGGCAAAGTGCAGACCACCAATAGACCACCAATGTCTTCTACTTGACTCTACTTGACCTATCGGGCGGACAATCCCGCGATCCTACCGAGAGATGTTGTAGGCGGAAACTCCTGGGCGCTCTGAGTACCCCGATCCTATCGAAGTGG

Full Affymetrix probeset data:

Annotations for 1628758_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720