FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628760_at:

>probe:Drosophila_2:1628760_at:681:571; Interrogation_Position=164; Antisense; GGCTAATCGCGGAATGACCAGTACT
>probe:Drosophila_2:1628760_at:177:411; Interrogation_Position=179; Antisense; GACCAGTACTGGCAAGCAACCGATT
>probe:Drosophila_2:1628760_at:383:41; Interrogation_Position=253; Antisense; ATCGGCCGGTGGTTGTGGACTTTCA
>probe:Drosophila_2:1628760_at:222:557; Interrogation_Position=269; Antisense; GGACTTTCATGCCAGCTGGTGCTGT
>probe:Drosophila_2:1628760_at:83:593; Interrogation_Position=285; Antisense; TGGTGCTGTCCATGCAAGGCTCTGG
>probe:Drosophila_2:1628760_at:447:581; Interrogation_Position=307; Antisense; TGGCCCCTCGACTGGAGAACGTTGT
>probe:Drosophila_2:1628760_at:70:467; Interrogation_Position=355; Antisense; GATTGGCCCGGGTCGATATTGATGA
>probe:Drosophila_2:1628760_at:107:383; Interrogation_Position=387; Antisense; GAACTGGCCCTTGACTACAACGTGG
>probe:Drosophila_2:1628760_at:121:509; Interrogation_Position=412; Antisense; GGTCCGTTCCTTCACTGGTGGTCAT
>probe:Drosophila_2:1628760_at:51:593; Interrogation_Position=427; Antisense; TGGTGGTCATCAGCAACGGCAAGGT
>probe:Drosophila_2:1628760_at:222:229; Interrogation_Position=461; Antisense; AATGGTTGGCCTGCAGACCAGCGAA
>probe:Drosophila_2:1628760_at:422:365; Interrogation_Position=483; Antisense; GAATACCTACGCAAGTGGCTCCATA
>probe:Drosophila_2:1628760_at:458:11; Interrogation_Position=574; Antisense; ATTAAACCACGTTCTCAGCAACACG
>probe:Drosophila_2:1628760_at:167:217; Interrogation_Position=623; Antisense; AAGTTTCTTAGGTGCATACACTCAA

Paste this into a BLAST search page for me
GGCTAATCGCGGAATGACCAGTACTGACCAGTACTGGCAAGCAACCGATTATCGGCCGGTGGTTGTGGACTTTCAGGACTTTCATGCCAGCTGGTGCTGTTGGTGCTGTCCATGCAAGGCTCTGGTGGCCCCTCGACTGGAGAACGTTGTGATTGGCCCGGGTCGATATTGATGAGAACTGGCCCTTGACTACAACGTGGGGTCCGTTCCTTCACTGGTGGTCATTGGTGGTCATCAGCAACGGCAAGGTAATGGTTGGCCTGCAGACCAGCGAAGAATACCTACGCAAGTGGCTCCATAATTAAACCACGTTCTCAGCAACACGAAGTTTCTTAGGTGCATACACTCAA

Full Affymetrix probeset data:

Annotations for 1628760_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720