Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628763_at:

>probe:Drosophila_2:1628763_at:696:131; Interrogation_Position=2795; Antisense; ACCCGTATATTTTGCCGAAAGTGCT
>probe:Drosophila_2:1628763_at:116:301; Interrogation_Position=2796; Antisense; CCCGTATATTTTGCCGAAAGTGCTG
>probe:Drosophila_2:1628763_at:597:199; Interrogation_Position=2933; Antisense; AACGCTACGCGCCACCCATAATTGG
>probe:Drosophila_2:1628763_at:192:313; Interrogation_Position=2943; Antisense; GCCACCCATAATTGGCGGTCGATAA
>probe:Drosophila_2:1628763_at:69:309; Interrogation_Position=2948; Antisense; CCATAATTGGCGGTCGATAACAAGA
>probe:Drosophila_2:1628763_at:26:727; Interrogation_Position=2954; Antisense; TTGGCGGTCGATAACAAGACGCAAA
>probe:Drosophila_2:1628763_at:678:211; Interrogation_Position=2969; Antisense; AAGACGCAAAGAGCAACCGAGAATG
>probe:Drosophila_2:1628763_at:516:421; Interrogation_Position=2979; Antisense; GAGCAACCGAGAATGCGAACCTTAT
>probe:Drosophila_2:1628763_at:703:201; Interrogation_Position=2983; Antisense; AACCGAGAATGCGAACCTTATACAC
>probe:Drosophila_2:1628763_at:152:423; Interrogation_Position=2987; Antisense; GAGAATGCGAACCTTATACACTGAT
>probe:Drosophila_2:1628763_at:201:49; Interrogation_Position=2991; Antisense; ATGCGAACCTTATACACTGATAGAC
>probe:Drosophila_2:1628763_at:239:381; Interrogation_Position=2995; Antisense; GAACCTTATACACTGATAGACATGA
>probe:Drosophila_2:1628763_at:617:665; Interrogation_Position=3003; Antisense; TACACTGATAGACATGAGAAGATAA
>probe:Drosophila_2:1628763_at:110:705; Interrogation_Position=3041; Antisense; TTAGCACCAAATCAATTCATAAATG

Paste this into a BLAST search page for me
ACCCGTATATTTTGCCGAAAGTGCTCCCGTATATTTTGCCGAAAGTGCTGAACGCTACGCGCCACCCATAATTGGGCCACCCATAATTGGCGGTCGATAACCATAATTGGCGGTCGATAACAAGATTGGCGGTCGATAACAAGACGCAAAAAGACGCAAAGAGCAACCGAGAATGGAGCAACCGAGAATGCGAACCTTATAACCGAGAATGCGAACCTTATACACGAGAATGCGAACCTTATACACTGATATGCGAACCTTATACACTGATAGACGAACCTTATACACTGATAGACATGATACACTGATAGACATGAGAAGATAATTAGCACCAAATCAATTCATAAATG

Full Affymetrix probeset data:

Annotations for 1628763_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime