FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628764_at:

>probe:Drosophila_2:1628764_at:715:33; Interrogation_Position=1050; Antisense; ATCACATGGACCTAATCTTATCGAG
>probe:Drosophila_2:1628764_at:180:101; Interrogation_Position=536; Antisense; AGAGCGTCACCGAGCTGAAGGCCAT
>probe:Drosophila_2:1628764_at:254:371; Interrogation_Position=552; Antisense; GAAGGCCATCTATCTGGATGCCCAG
>probe:Drosophila_2:1628764_at:24:265; Interrogation_Position=574; Antisense; CAGCAGAGCCTGTTCGATCGATATA
>probe:Drosophila_2:1628764_at:445:25; Interrogation_Position=596; Antisense; ATAGGGCCATGTTCAGCCTGCGCAA
>probe:Drosophila_2:1628764_at:246:325; Interrogation_Position=615; Antisense; GCGCAATCTGCGCACCGAAGAGAGT
>probe:Drosophila_2:1628764_at:571:213; Interrogation_Position=632; Antisense; AAGAGAGTGTCTTGGCCATTGCCGA
>probe:Drosophila_2:1628764_at:383:115; Interrogation_Position=730; Antisense; AGCATTCCCTTCCTTCAAGAGAATC
>probe:Drosophila_2:1628764_at:648:167; Interrogation_Position=776; Antisense; AAATGGTGCGTCACGAGTGTGCCGA
>probe:Drosophila_2:1628764_at:52:405; Interrogation_Position=826; Antisense; GACTGCATTCAGATCTTGAACCGCT
>probe:Drosophila_2:1628764_at:607:291; Interrogation_Position=870; Antisense; CGTGGTCAAGGAGAGCTGCGTCATC
>probe:Drosophila_2:1628764_at:582:321; Interrogation_Position=895; Antisense; GCCCTGGACATGTGCGAGTACGAGA
>probe:Drosophila_2:1628764_at:529:549; Interrogation_Position=927; Antisense; GGAGTTCCAATATGCCGACGGCCTA
>probe:Drosophila_2:1628764_at:382:461; Interrogation_Position=974; Antisense; GATTTTCGCCGAACATTTGCATCTA

Paste this into a BLAST search page for me
ATCACATGGACCTAATCTTATCGAGAGAGCGTCACCGAGCTGAAGGCCATGAAGGCCATCTATCTGGATGCCCAGCAGCAGAGCCTGTTCGATCGATATAATAGGGCCATGTTCAGCCTGCGCAAGCGCAATCTGCGCACCGAAGAGAGTAAGAGAGTGTCTTGGCCATTGCCGAAGCATTCCCTTCCTTCAAGAGAATCAAATGGTGCGTCACGAGTGTGCCGAGACTGCATTCAGATCTTGAACCGCTCGTGGTCAAGGAGAGCTGCGTCATCGCCCTGGACATGTGCGAGTACGAGAGGAGTTCCAATATGCCGACGGCCTAGATTTTCGCCGAACATTTGCATCTA

Full Affymetrix probeset data:

Annotations for 1628764_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720