FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628766_at:

>probe:Drosophila_2:1628766_at:226:3; Interrogation_Position=1390; Antisense; ATTGGACTATATCCGGACGCAGGCG
>probe:Drosophila_2:1628766_at:167:277; Interrogation_Position=1417; Antisense; CTTTGCCTGCATAACACTGTTCGTG
>probe:Drosophila_2:1628766_at:57:143; Interrogation_Position=1432; Antisense; ACTGTTCGTGATGAGCTTGGGTGCC
>probe:Drosophila_2:1628766_at:437:713; Interrogation_Position=1460; Antisense; TTCTCCTTCTACACGTTCATGAATC
>probe:Drosophila_2:1628766_at:161:55; Interrogation_Position=1478; Antisense; ATGAATCCGCGCTACATGTTCAAGC
>probe:Drosophila_2:1628766_at:374:711; Interrogation_Position=1565; Antisense; TTCTCCTCGATTGACTACACCAAAG
>probe:Drosophila_2:1628766_at:421:271; Interrogation_Position=1592; Antisense; CATCTGTTCTATGCGTATCCTGAAG
>probe:Drosophila_2:1628766_at:658:565; Interrogation_Position=1618; Antisense; GGCGCAACTAACTTATGGCTACGGC
>probe:Drosophila_2:1628766_at:306:317; Interrogation_Position=1652; Antisense; GCCTGGTTCACGTTCGTGGACAATA
>probe:Drosophila_2:1628766_at:550:23; Interrogation_Position=1674; Antisense; ATATCCTGTGCGGTGTTATGTTCCT
>probe:Drosophila_2:1628766_at:376:681; Interrogation_Position=1690; Antisense; TATGTTCCTCTGGTATTCTGGCAAG
>probe:Drosophila_2:1628766_at:591:409; Interrogation_Position=1757; Antisense; GACGAGCCGACCATCATGGGCAGAT
>probe:Drosophila_2:1628766_at:566:479; Interrogation_Position=1809; Antisense; GTATTACCTAATGCCCATACTGCGA
>probe:Drosophila_2:1628766_at:474:661; Interrogation_Position=1855; Antisense; TAACTATCCGCCATTGCTTATCATT

Paste this into a BLAST search page for me
ATTGGACTATATCCGGACGCAGGCGCTTTGCCTGCATAACACTGTTCGTGACTGTTCGTGATGAGCTTGGGTGCCTTCTCCTTCTACACGTTCATGAATCATGAATCCGCGCTACATGTTCAAGCTTCTCCTCGATTGACTACACCAAAGCATCTGTTCTATGCGTATCCTGAAGGGCGCAACTAACTTATGGCTACGGCGCCTGGTTCACGTTCGTGGACAATAATATCCTGTGCGGTGTTATGTTCCTTATGTTCCTCTGGTATTCTGGCAAGGACGAGCCGACCATCATGGGCAGATGTATTACCTAATGCCCATACTGCGATAACTATCCGCCATTGCTTATCATT

Full Affymetrix probeset data:

Annotations for 1628766_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720