FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628770_at:

>probe:Drosophila_2:1628770_at:437:317; Interrogation_Position=102; Antisense; GCCGCCGGATACCATACTGGGCGAA
>probe:Drosophila_2:1628770_at:396:29; Interrogation_Position=115; Antisense; ATACTGGGCGAATTCCTTGGCTACC
>probe:Drosophila_2:1628770_at:264:729; Interrogation_Position=131; Antisense; TTGGCTACCGCATCACATATCGACC
>probe:Drosophila_2:1628770_at:262:405; Interrogation_Position=160; Antisense; GATCGGGACCCCAACGATACCAAGG
>probe:Drosophila_2:1628770_at:576:457; Interrogation_Position=175; Antisense; GATACCAAGGAAATCTATATACGCG
>probe:Drosophila_2:1628770_at:350:687; Interrogation_Position=190; Antisense; TATATACGCGACAACACCGTGGAGT
>probe:Drosophila_2:1628770_at:170:187; Interrogation_Position=202; Antisense; AACACCGTGGAGTTGGACTTCTTCT
>probe:Drosophila_2:1628770_at:591:401; Interrogation_Position=217; Antisense; GACTTCTTCTTTTTTCGCAGCGGTA
>probe:Drosophila_2:1628770_at:397:701; Interrogation_Position=228; Antisense; TTTTCGCAGCGGTAAAAACACGCAG
>probe:Drosophila_2:1628770_at:614:1; Interrogation_Position=265; Antisense; ATTCCAATTTCTGAGAAGACTTCTC
>probe:Drosophila_2:1628770_at:96:377; Interrogation_Position=279; Antisense; GAAGACTTCTCTTGATGTGACCAAA
>probe:Drosophila_2:1628770_at:327:139; Interrogation_Position=31; Antisense; ACGGGCAAGCCCATACCGACGACGG
>probe:Drosophila_2:1628770_at:4:275; Interrogation_Position=75; Antisense; CTCGGTGTACATCTCGTGGAAGGCA
>probe:Drosophila_2:1628770_at:710:489; Interrogation_Position=81; Antisense; GTACATCTCGTGGAAGGCACCGCCG

Paste this into a BLAST search page for me
GCCGCCGGATACCATACTGGGCGAAATACTGGGCGAATTCCTTGGCTACCTTGGCTACCGCATCACATATCGACCGATCGGGACCCCAACGATACCAAGGGATACCAAGGAAATCTATATACGCGTATATACGCGACAACACCGTGGAGTAACACCGTGGAGTTGGACTTCTTCTGACTTCTTCTTTTTTCGCAGCGGTATTTTCGCAGCGGTAAAAACACGCAGATTCCAATTTCTGAGAAGACTTCTCGAAGACTTCTCTTGATGTGACCAAAACGGGCAAGCCCATACCGACGACGGCTCGGTGTACATCTCGTGGAAGGCAGTACATCTCGTGGAAGGCACCGCCG

Full Affymetrix probeset data:

Annotations for 1628770_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720