Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628775_s_at:

>probe:Drosophila_2:1628775_s_at:227:201; Interrogation_Position=562; Antisense; AACCGCGCCATGGTTGGCATCGTCG
>probe:Drosophila_2:1628775_s_at:343:499; Interrogation_Position=596; Antisense; GTCGTATCGACAAGCCCATCCTGAA
>probe:Drosophila_2:1628775_s_at:104:537; Interrogation_Position=625; Antisense; GGTCGTGCCTACCACAAGTACAAGG
>probe:Drosophila_2:1628775_s_at:159:79; Interrogation_Position=647; Antisense; AGGTGAAGCGCAACAGCTGGCCTAA
>probe:Drosophila_2:1628775_s_at:383:595; Interrogation_Position=681; Antisense; TGTGGCCATGAACCCCGTGGAGCAT
>probe:Drosophila_2:1628775_s_at:624:585; Interrogation_Position=698; Antisense; TGGAGCATCCTCACGGTGGTGGTAA
>probe:Drosophila_2:1628775_s_at:191:517; Interrogation_Position=713; Antisense; GTGGTGGTAACCATCAGCACATTGG
>probe:Drosophila_2:1628775_s_at:484:111; Interrogation_Position=728; Antisense; AGCACATTGGTAAGGCCTCCACCGT
>probe:Drosophila_2:1628775_s_at:173:289; Interrogation_Position=771; Antisense; CGGTCGCAAGGTCGGTCTCATCGCT
>probe:Drosophila_2:1628775_s_at:588:559; Interrogation_Position=840; Antisense; GGACAAGTAAGCTCTGGCTGCAGCA
>probe:Drosophila_2:1628775_s_at:354:79; Interrogation_Position=882; Antisense; AGGTTCCGCCTGAGATCTGGGTAGT
>probe:Drosophila_2:1628775_s_at:334:41; Interrogation_Position=896; Antisense; ATCTGGGTAGTGGTCGTGCTCTGCT
>probe:Drosophila_2:1628775_s_at:609:331; Interrogation_Position=923; Antisense; GCGGCGTCGTGGAAGAAATTGCTAT
>probe:Drosophila_2:1628775_s_at:129:679; Interrogation_Position=972; Antisense; TAGGCATACGCTTGACACGGCAGAA

Paste this into a BLAST search page for me
AACCGCGCCATGGTTGGCATCGTCGGTCGTATCGACAAGCCCATCCTGAAGGTCGTGCCTACCACAAGTACAAGGAGGTGAAGCGCAACAGCTGGCCTAATGTGGCCATGAACCCCGTGGAGCATTGGAGCATCCTCACGGTGGTGGTAAGTGGTGGTAACCATCAGCACATTGGAGCACATTGGTAAGGCCTCCACCGTCGGTCGCAAGGTCGGTCTCATCGCTGGACAAGTAAGCTCTGGCTGCAGCAAGGTTCCGCCTGAGATCTGGGTAGTATCTGGGTAGTGGTCGTGCTCTGCTGCGGCGTCGTGGAAGAAATTGCTATTAGGCATACGCTTGACACGGCAGAA

Full Affymetrix probeset data:

Annotations for 1628775_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime