FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628777_at:

>probe:Drosophila_2:1628777_at:698:207; Interrogation_Position=1716; Antisense; AATCCATTGGGACTGTACGGTGGTC
>probe:Drosophila_2:1628777_at:457:667; Interrogation_Position=1731; Antisense; TACGGTGGTCTTGTGCTCAGTGGCT
>probe:Drosophila_2:1628777_at:164:83; Interrogation_Position=1749; Antisense; AGTGGCTTCTCCATTTTCATGGGCG
>probe:Drosophila_2:1628777_at:27:181; Interrogation_Position=1794; Antisense; AAACACGGTCCCCAGGATCACGAGT
>probe:Drosophila_2:1628777_at:654:453; Interrogation_Position=1809; Antisense; GATCACGAGTCCTTGAAGCCAGCTA
>probe:Drosophila_2:1628777_at:527:645; Interrogation_Position=1893; Antisense; TCTTCGGTAGCACTGACGGGCACAA
>probe:Drosophila_2:1628777_at:75:45; Interrogation_Position=1965; Antisense; ATCCCCGTGGACCATAATTTGGCGC
>probe:Drosophila_2:1628777_at:232:653; Interrogation_Position=1979; Antisense; TAATTTGGCGCTGTACGAGGGACCC
>probe:Drosophila_2:1628777_at:571:671; Interrogation_Position=1992; Antisense; TACGAGGGACCCGAGCAGAGATTCT
>probe:Drosophila_2:1628777_at:366:575; Interrogation_Position=2024; Antisense; TGGCGTTTACGAGTACGTGCCCAAC
>probe:Drosophila_2:1628777_at:358:619; Interrogation_Position=2091; Antisense; TGCATCCACTGCAAGACCTGTGATA
>probe:Drosophila_2:1628777_at:685:513; Interrogation_Position=2110; Antisense; GTGATATCAAGGACCCCAAGCAGAA
>probe:Drosophila_2:1628777_at:54:31; Interrogation_Position=2194; Antisense; ATAACTATCGCAGCCAATCCGTGTA
>probe:Drosophila_2:1628777_at:136:47; Interrogation_Position=2210; Antisense; ATCCGTGTACCGCAATTGCATTTCA

Paste this into a BLAST search page for me
AATCCATTGGGACTGTACGGTGGTCTACGGTGGTCTTGTGCTCAGTGGCTAGTGGCTTCTCCATTTTCATGGGCGAAACACGGTCCCCAGGATCACGAGTGATCACGAGTCCTTGAAGCCAGCTATCTTCGGTAGCACTGACGGGCACAAATCCCCGTGGACCATAATTTGGCGCTAATTTGGCGCTGTACGAGGGACCCTACGAGGGACCCGAGCAGAGATTCTTGGCGTTTACGAGTACGTGCCCAACTGCATCCACTGCAAGACCTGTGATAGTGATATCAAGGACCCCAAGCAGAAATAACTATCGCAGCCAATCCGTGTAATCCGTGTACCGCAATTGCATTTCA

Full Affymetrix probeset data:

Annotations for 1628777_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720