Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628778_at:

>probe:Drosophila_2:1628778_at:73:251; Interrogation_Position=2505; Antisense; CAATCATTCGCTGGCTATTTGAGAG
>probe:Drosophila_2:1628778_at:38:297; Interrogation_Position=2570; Antisense; CGACGCAGGACACCGCCAGAGAAAG
>probe:Drosophila_2:1628778_at:389:617; Interrogation_Position=2631; Antisense; TGCAGCTGGCGATTTGCGCGCGTTT
>probe:Drosophila_2:1628778_at:252:619; Interrogation_Position=2676; Antisense; TGCTTACCGTTTTTGTTTTGGCAAG
>probe:Drosophila_2:1628778_at:323:585; Interrogation_Position=2694; Antisense; TGGCAAGAATGCTTCGGATCGCCCT
>probe:Drosophila_2:1628778_at:661:677; Interrogation_Position=2734; Antisense; TAGAGGCTCTTCAGCTGCACGAGGA
>probe:Drosophila_2:1628778_at:603:199; Interrogation_Position=2772; Antisense; AACGAATGGCGCGATACCCTGGGTC
>probe:Drosophila_2:1628778_at:100:221; Interrogation_Position=2804; Antisense; AAGTGCGATTCTCTGGGATTTTCTG
>probe:Drosophila_2:1628778_at:165:541; Interrogation_Position=2819; Antisense; GGATTTTCTGGCACCGTCACTGGCA
>probe:Drosophila_2:1628778_at:502:495; Interrogation_Position=2834; Antisense; GTCACTGGCACGAGCAGCTACTTAA
>probe:Drosophila_2:1628778_at:17:661; Interrogation_Position=2894; Antisense; TAACTGTGGCAGAACACGGCACGAA
>probe:Drosophila_2:1628778_at:564:139; Interrogation_Position=2909; Antisense; ACGGCACGAAACTATGGCAACCAGG
>probe:Drosophila_2:1628778_at:652:563; Interrogation_Position=2924; Antisense; GGCAACCAGGAAACGATCGACCCGA
>probe:Drosophila_2:1628778_at:443:637; Interrogation_Position=2940; Antisense; TCGACCCGAGGAATGTGTACCACTT

Paste this into a BLAST search page for me
CAATCATTCGCTGGCTATTTGAGAGCGACGCAGGACACCGCCAGAGAAAGTGCAGCTGGCGATTTGCGCGCGTTTTGCTTACCGTTTTTGTTTTGGCAAGTGGCAAGAATGCTTCGGATCGCCCTTAGAGGCTCTTCAGCTGCACGAGGAAACGAATGGCGCGATACCCTGGGTCAAGTGCGATTCTCTGGGATTTTCTGGGATTTTCTGGCACCGTCACTGGCAGTCACTGGCACGAGCAGCTACTTAATAACTGTGGCAGAACACGGCACGAAACGGCACGAAACTATGGCAACCAGGGGCAACCAGGAAACGATCGACCCGATCGACCCGAGGAATGTGTACCACTT

Full Affymetrix probeset data:

Annotations for 1628778_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime