FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628780_at:

>probe:Drosophila_2:1628780_at:343:553; Interrogation_Position=116; Antisense; GGAGCGTGGTCTCGTTTTCAACGAA
>probe:Drosophila_2:1628780_at:588:127; Interrogation_Position=147; Antisense; ACCAGGATCTGGTCTAAATTGCACC
>probe:Drosophila_2:1628780_at:292:163; Interrogation_Position=162; Antisense; AAATTGCACCGTTTTGTATCTGGAT
>probe:Drosophila_2:1628780_at:572:483; Interrogation_Position=177; Antisense; GTATCTGGATCAGTGCACATCCTGG
>probe:Drosophila_2:1628780_at:63:357; Interrogation_Position=191; Antisense; GCACATCCTGGAATAAGTGTCGACA
>probe:Drosophila_2:1628780_at:291:221; Interrogation_Position=205; Antisense; AAGTGTCGACAGACCTGCCTGAAAA
>probe:Drosophila_2:1628780_at:727:179; Interrogation_Position=226; Antisense; AAAACCGGAGCCACCAGCTACAGGT
>probe:Drosophila_2:1628780_at:370:117; Interrogation_Position=241; Antisense; AGCTACAGGTGGTTTCATGACGGAT
>probe:Drosophila_2:1628780_at:267:385; Interrogation_Position=283; Antisense; GAACTTTGCATGAATTACGGCGTAA
>probe:Drosophila_2:1628780_at:291:105; Interrogation_Position=29; Antisense; AGAAATCGCACACCGAGGAATTCGA
>probe:Drosophila_2:1628780_at:714:607; Interrogation_Position=309; Antisense; TGAGAGCAGATGTCGACTATGTCCT
>probe:Drosophila_2:1628780_at:346:143; Interrogation_Position=324; Antisense; ACTATGTCCTGAACCCGGACTTGAA
>probe:Drosophila_2:1628780_at:442:371; Interrogation_Position=52; Antisense; GAAGGAATGCCAGCCTTGTTCAGGG
>probe:Drosophila_2:1628780_at:52:269; Interrogation_Position=78; Antisense; CATGTCCTCATCTCCAAACGATGGA

Paste this into a BLAST search page for me
GGAGCGTGGTCTCGTTTTCAACGAAACCAGGATCTGGTCTAAATTGCACCAAATTGCACCGTTTTGTATCTGGATGTATCTGGATCAGTGCACATCCTGGGCACATCCTGGAATAAGTGTCGACAAAGTGTCGACAGACCTGCCTGAAAAAAAACCGGAGCCACCAGCTACAGGTAGCTACAGGTGGTTTCATGACGGATGAACTTTGCATGAATTACGGCGTAAAGAAATCGCACACCGAGGAATTCGATGAGAGCAGATGTCGACTATGTCCTACTATGTCCTGAACCCGGACTTGAAGAAGGAATGCCAGCCTTGTTCAGGGCATGTCCTCATCTCCAAACGATGGA

Full Affymetrix probeset data:

Annotations for 1628780_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720