Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628782_at:

>probe:Drosophila_2:1628782_at:143:573; Interrogation_Position=3622; Antisense; GGCTGGATAAGCATTAGATAACTCT
>probe:Drosophila_2:1628782_at:332:257; Interrogation_Position=3659; Antisense; CAAAGGACTTCGATACATATGTATA
>probe:Drosophila_2:1628782_at:372:23; Interrogation_Position=3681; Antisense; ATATCATTAGCAGCTGGCAGCCGTG
>probe:Drosophila_2:1628782_at:666:567; Interrogation_Position=3696; Antisense; GGCAGCCGTGTAAATATCCAAGCAG
>probe:Drosophila_2:1628782_at:315:683; Interrogation_Position=3710; Antisense; TATCCAAGCAGCGACCAAAGAATGT
>probe:Drosophila_2:1628782_at:305:457; Interrogation_Position=3744; Antisense; GATAGAGATACCAAGATACCGAGAT
>probe:Drosophila_2:1628782_at:661:91; Interrogation_Position=3871; Antisense; AGTTACTGTACAGCTATAGGAGCAA
>probe:Drosophila_2:1628782_at:335:257; Interrogation_Position=3893; Antisense; CAAAGTGGATCCGTGGGAACGATAA
>probe:Drosophila_2:1628782_at:286:529; Interrogation_Position=3920; Antisense; GGGTAACTACTCGTAATGTGCTTAA
>probe:Drosophila_2:1628782_at:58:243; Interrogation_Position=3966; Antisense; AATATGTGGACACCCACAGGCACCA
>probe:Drosophila_2:1628782_at:335:567; Interrogation_Position=3984; Antisense; GGCACCAAGCGAGCTGTGGGTCATA
>probe:Drosophila_2:1628782_at:521:457; Interrogation_Position=4036; Antisense; GATATGAATTGGCTTCTCGAGATTG
>probe:Drosophila_2:1628782_at:98:639; Interrogation_Position=4050; Antisense; TCTCGAGATTGTTTTGTCCGTTGTG
>probe:Drosophila_2:1628782_at:68:503; Interrogation_Position=4065; Antisense; GTCCGTTGTGTGTACATTTTAGTTA

Paste this into a BLAST search page for me
GGCTGGATAAGCATTAGATAACTCTCAAAGGACTTCGATACATATGTATAATATCATTAGCAGCTGGCAGCCGTGGGCAGCCGTGTAAATATCCAAGCAGTATCCAAGCAGCGACCAAAGAATGTGATAGAGATACCAAGATACCGAGATAGTTACTGTACAGCTATAGGAGCAACAAAGTGGATCCGTGGGAACGATAAGGGTAACTACTCGTAATGTGCTTAAAATATGTGGACACCCACAGGCACCAGGCACCAAGCGAGCTGTGGGTCATAGATATGAATTGGCTTCTCGAGATTGTCTCGAGATTGTTTTGTCCGTTGTGGTCCGTTGTGTGTACATTTTAGTTA

Full Affymetrix probeset data:

Annotations for 1628782_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime