Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628783_at:

>probe:Drosophila_2:1628783_at:516:599; Interrogation_Position=3371; Antisense; TGTAACCAGTAACCGTTGACCCCAT
>probe:Drosophila_2:1628783_at:213:129; Interrogation_Position=3423; Antisense; ACCAGTCATTCAGCTCTGCATTTAA
>probe:Drosophila_2:1628783_at:326:201; Interrogation_Position=3454; Antisense; AACCGTGTTGTATATCCGTAATCGT
>probe:Drosophila_2:1628783_at:607:493; Interrogation_Position=3471; Antisense; GTAATCGTATCGTATCTGTGTGCTA
>probe:Drosophila_2:1628783_at:472:675; Interrogation_Position=3494; Antisense; TAGTTTATAGCCCTTAGTTCCCTCA
>probe:Drosophila_2:1628783_at:219:281; Interrogation_Position=3515; Antisense; CTCACAACCAGCGTAGTCAGTCAAA
>probe:Drosophila_2:1628783_at:602:679; Interrogation_Position=3557; Antisense; TAGGCAGGATCCTCACTCATATGCA
>probe:Drosophila_2:1628783_at:491:215; Interrogation_Position=3586; Antisense; AAGATCTTTTGGACGGGCACTTGCG
>probe:Drosophila_2:1628783_at:29:517; Interrogation_Position=3741; Antisense; GGGTCTTAGCTTGTTGACCGCCCAA
>probe:Drosophila_2:1628783_at:705:139; Interrogation_Position=3756; Antisense; GACCGCCCAAGGGAGCTTTAACTGG
>probe:Drosophila_2:1628783_at:277:457; Interrogation_Position=3781; Antisense; GATTTGTCGAGTGTTGGACTGCCCC
>probe:Drosophila_2:1628783_at:500:347; Interrogation_Position=3807; Antisense; GCATCGAAGTGAAGAGCCGTCCAGA
>probe:Drosophila_2:1628783_at:678:391; Interrogation_Position=3845; Antisense; GAAAGCCAGTGCGACAGCATCGTCT
>probe:Drosophila_2:1628783_at:195:727; Interrogation_Position=3874; Antisense; TTGTCTGGCCTGATCTGTATTCGTA

Paste this into a BLAST search page for me
TGTAACCAGTAACCGTTGACCCCATACCAGTCATTCAGCTCTGCATTTAAAACCGTGTTGTATATCCGTAATCGTGTAATCGTATCGTATCTGTGTGCTATAGTTTATAGCCCTTAGTTCCCTCACTCACAACCAGCGTAGTCAGTCAAATAGGCAGGATCCTCACTCATATGCAAAGATCTTTTGGACGGGCACTTGCGGGGTCTTAGCTTGTTGACCGCCCAAGACCGCCCAAGGGAGCTTTAACTGGGATTTGTCGAGTGTTGGACTGCCCCGCATCGAAGTGAAGAGCCGTCCAGAGAAAGCCAGTGCGACAGCATCGTCTTTGTCTGGCCTGATCTGTATTCGTA

Full Affymetrix probeset data:

Annotations for 1628783_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime