Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628785_at:

>probe:Drosophila_2:1628785_at:643:67; Interrogation_Position=1901; Antisense; ATGGCAGCTAGCCTAGAGCAACCGG
>probe:Drosophila_2:1628785_at:249:109; Interrogation_Position=1946; Antisense; AGAAGTCCCGATCTGTACACTGACT
>probe:Drosophila_2:1628785_at:359:491; Interrogation_Position=1960; Antisense; GTACACTGACTTTAACTGATCTCCC
>probe:Drosophila_2:1628785_at:647:445; Interrogation_Position=1977; Antisense; GATCTCCCCGGGATGGAGGCTTTAA
>probe:Drosophila_2:1628785_at:223:601; Interrogation_Position=2040; Antisense; TGTAAACACTGTATCCCACGACTTC
>probe:Drosophila_2:1628785_at:404:419; Interrogation_Position=2070; Antisense; GAGCTTGTTTTTAGATGACCCCGCA
>probe:Drosophila_2:1628785_at:30:445; Interrogation_Position=2083; Antisense; GATGACCCCGCAAACATTTTATGTT
>probe:Drosophila_2:1628785_at:665:479; Interrogation_Position=2105; Antisense; GTTTCCGTATTATCTGTTGCATTGG
>probe:Drosophila_2:1628785_at:31:325; Interrogation_Position=2181; Antisense; GCGCAAACTCGTGATGTTGGTTGAT
>probe:Drosophila_2:1628785_at:169:371; Interrogation_Position=2252; Antisense; GAAGGACCTAACTATCGACGGCTAG
>probe:Drosophila_2:1628785_at:558:361; Interrogation_Position=2290; Antisense; GCAATGTTAAATGCCAGCCACTCCA
>probe:Drosophila_2:1628785_at:691:181; Interrogation_Position=2317; Antisense; AAAACGGCGAATCTGATCCGGGACA
>probe:Drosophila_2:1628785_at:136:557; Interrogation_Position=2342; Antisense; GGACGTCCCGCACAGCGATTGAAAA
>probe:Drosophila_2:1628785_at:432:149; Interrogation_Position=2417; Antisense; ACTTCAGTAGTTTGTGCTTCAGTAC

Paste this into a BLAST search page for me
ATGGCAGCTAGCCTAGAGCAACCGGAGAAGTCCCGATCTGTACACTGACTGTACACTGACTTTAACTGATCTCCCGATCTCCCCGGGATGGAGGCTTTAATGTAAACACTGTATCCCACGACTTCGAGCTTGTTTTTAGATGACCCCGCAGATGACCCCGCAAACATTTTATGTTGTTTCCGTATTATCTGTTGCATTGGGCGCAAACTCGTGATGTTGGTTGATGAAGGACCTAACTATCGACGGCTAGGCAATGTTAAATGCCAGCCACTCCAAAAACGGCGAATCTGATCCGGGACAGGACGTCCCGCACAGCGATTGAAAAACTTCAGTAGTTTGTGCTTCAGTAC

Full Affymetrix probeset data:

Annotations for 1628785_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime