Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628787_s_at:

>probe:Drosophila_2:1628787_s_at:554:637; Interrogation_Position=109; Antisense; TCGAGTGAGATAGAGATGGTGCCCC
>probe:Drosophila_2:1628787_s_at:631:37; Interrogation_Position=135; Antisense; ATCTTCTCCAGCTCGAAATTGCTAC
>probe:Drosophila_2:1628787_s_at:666:261; Interrogation_Position=143; Antisense; CAGCTCGAAATTGCTACTCTGATTT
>probe:Drosophila_2:1628787_s_at:530:7; Interrogation_Position=152; Antisense; ATTGCTACTCTGATTTGTGGCTGCC
>probe:Drosophila_2:1628787_s_at:654:667; Interrogation_Position=157; Antisense; TACTCTGATTTGTGGCTGCCGTTCG
>probe:Drosophila_2:1628787_s_at:303:283; Interrogation_Position=172; Antisense; CTGCCGTTCGGAGGCGAGAGTCGCT
>probe:Drosophila_2:1628787_s_at:479:85; Interrogation_Position=190; Antisense; AGTCGCTGGTCCCTAGCCGGGATTC
>probe:Drosophila_2:1628787_s_at:414:305; Interrogation_Position=201; Antisense; CCTAGCCGGGATTCAGTATTCTGGA
>probe:Drosophila_2:1628787_s_at:686:461; Interrogation_Position=210; Antisense; GATTCAGTATTCTGGATTCTGGACT
>probe:Drosophila_2:1628787_s_at:134:689; Interrogation_Position=217; Antisense; TATTCTGGATTCTGGACTCCAGCCT
>probe:Drosophila_2:1628787_s_at:175:543; Interrogation_Position=223; Antisense; GGATTCTGGACTCCAGCCTCCGTTG
>probe:Drosophila_2:1628787_s_at:628:631; Interrogation_Position=241; Antisense; TCCGTTGCGGCCAAATTCATGCTTA
>probe:Drosophila_2:1628787_s_at:540:469; Interrogation_Position=244; Antisense; GTTGCGGCCAAATTCATGCTTATGA
>probe:Drosophila_2:1628787_s_at:145:13; Interrogation_Position=255; Antisense; ATTCATGCTTATGAGCACTTGCCGT

Paste this into a BLAST search page for me
TCGAGTGAGATAGAGATGGTGCCCCATCTTCTCCAGCTCGAAATTGCTACCAGCTCGAAATTGCTACTCTGATTTATTGCTACTCTGATTTGTGGCTGCCTACTCTGATTTGTGGCTGCCGTTCGCTGCCGTTCGGAGGCGAGAGTCGCTAGTCGCTGGTCCCTAGCCGGGATTCCCTAGCCGGGATTCAGTATTCTGGAGATTCAGTATTCTGGATTCTGGACTTATTCTGGATTCTGGACTCCAGCCTGGATTCTGGACTCCAGCCTCCGTTGTCCGTTGCGGCCAAATTCATGCTTAGTTGCGGCCAAATTCATGCTTATGAATTCATGCTTATGAGCACTTGCCGT

Full Affymetrix probeset data:

Annotations for 1628787_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime