FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628790_at:

>probe:Drosophila_2:1628790_at:468:467; Interrogation_Position=1848; Antisense; GTTGTTTTAACATCACGTCTCATTG
>probe:Drosophila_2:1628790_at:109:651; Interrogation_Position=1897; Antisense; TCACTCCTGCCATGATACTTTGCAA
>probe:Drosophila_2:1628790_at:303:383; Interrogation_Position=1935; Antisense; GAACTGAAAGATCTCGGCACTGGCA
>probe:Drosophila_2:1628790_at:7:393; Interrogation_Position=2001; Antisense; GAAAGAGCCCTTTGTCTGGATCAAC
>probe:Drosophila_2:1628790_at:166:149; Interrogation_Position=2088; Antisense; ACTTTGGTCCGGATCTAGCACATAC
>probe:Drosophila_2:1628790_at:637:29; Interrogation_Position=2109; Antisense; ATACTCGCCCTGCTCGTTGATGATG
>probe:Drosophila_2:1628790_at:675:519; Interrogation_Position=2136; Antisense; GTGGACAGCCGCAAAGCTATACTTT
>probe:Drosophila_2:1628790_at:604:663; Interrogation_Position=2160; Antisense; TAAAGGCAGGCCTCCGATGAGCATG
>probe:Drosophila_2:1628790_at:723:55; Interrogation_Position=2176; Antisense; ATGAGCATGGCTAGGCAGGCGCAAT
>probe:Drosophila_2:1628790_at:235:249; Interrogation_Position=2197; Antisense; CAATTTACGGCGCAGGCATCAATCT
>probe:Drosophila_2:1628790_at:548:181; Interrogation_Position=2268; Antisense; AAAAACATACACTGCCACGATCTTC
>probe:Drosophila_2:1628790_at:391:617; Interrogation_Position=2306; Antisense; TGCACGGACATCTTGGAGCGCGGAT
>probe:Drosophila_2:1628790_at:15:401; Interrogation_Position=2339; Antisense; GACAGGAGGGCCAGTTCCAGCACAT
>probe:Drosophila_2:1628790_at:463:367; Interrogation_Position=2382; Antisense; GAATCCGATCGGTAACCTGCGGCAG

Paste this into a BLAST search page for me
GTTGTTTTAACATCACGTCTCATTGTCACTCCTGCCATGATACTTTGCAAGAACTGAAAGATCTCGGCACTGGCAGAAAGAGCCCTTTGTCTGGATCAACACTTTGGTCCGGATCTAGCACATACATACTCGCCCTGCTCGTTGATGATGGTGGACAGCCGCAAAGCTATACTTTTAAAGGCAGGCCTCCGATGAGCATGATGAGCATGGCTAGGCAGGCGCAATCAATTTACGGCGCAGGCATCAATCTAAAAACATACACTGCCACGATCTTCTGCACGGACATCTTGGAGCGCGGATGACAGGAGGGCCAGTTCCAGCACATGAATCCGATCGGTAACCTGCGGCAG

Full Affymetrix probeset data:

Annotations for 1628790_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720