FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628791_at:

>probe:Drosophila_2:1628791_at:304:609; Interrogation_Position=2574; Antisense; TGACTGAATTTACTTTGATATCGAA
>probe:Drosophila_2:1628791_at:350:243; Interrogation_Position=2657; Antisense; AATTTAGGGCCAAAGGAGATACGCT
>probe:Drosophila_2:1628791_at:561:427; Interrogation_Position=2672; Antisense; GAGATACGCTTGATCTGAAGCTGTT
>probe:Drosophila_2:1628791_at:220:377; Interrogation_Position=2688; Antisense; GAAGCTGTTGCGTATGAGATATGAA
>probe:Drosophila_2:1628791_at:698:53; Interrogation_Position=2740; Antisense; ATGAAACACACACAAGAAGCCAATT
>probe:Drosophila_2:1628791_at:695:185; Interrogation_Position=2782; Antisense; AACACGTGCAATTTCTTTGATACGA
>probe:Drosophila_2:1628791_at:174:149; Interrogation_Position=2817; Antisense; ACTATTGTGGGAGAGACACGCTCAT
>probe:Drosophila_2:1628791_at:33:425; Interrogation_Position=2829; Antisense; GAGACACGCTCATCTATGTTTTGTA
>probe:Drosophila_2:1628791_at:530:493; Interrogation_Position=2851; Antisense; GTAATTCTATACGTACAACTTTGTG
>probe:Drosophila_2:1628791_at:317:191; Interrogation_Position=2867; Antisense; AACTTTGTGAACTGTAATGCGCTTT
>probe:Drosophila_2:1628791_at:85:699; Interrogation_Position=2889; Antisense; TTTACACTATACAAGCACATCCCGC
>probe:Drosophila_2:1628791_at:118:87; Interrogation_Position=2946; Antisense; AGTCCCTCATGCTGCGTAAGTTATA
>probe:Drosophila_2:1628791_at:662:553; Interrogation_Position=3043; Antisense; GGAGCGAGGCGTTATGTAATTATTA
>probe:Drosophila_2:1628791_at:492:195; Interrogation_Position=3092; Antisense; AACTGTTGTTAATCTCTGTATCTAT

Paste this into a BLAST search page for me
TGACTGAATTTACTTTGATATCGAAAATTTAGGGCCAAAGGAGATACGCTGAGATACGCTTGATCTGAAGCTGTTGAAGCTGTTGCGTATGAGATATGAAATGAAACACACACAAGAAGCCAATTAACACGTGCAATTTCTTTGATACGAACTATTGTGGGAGAGACACGCTCATGAGACACGCTCATCTATGTTTTGTAGTAATTCTATACGTACAACTTTGTGAACTTTGTGAACTGTAATGCGCTTTTTTACACTATACAAGCACATCCCGCAGTCCCTCATGCTGCGTAAGTTATAGGAGCGAGGCGTTATGTAATTATTAAACTGTTGTTAATCTCTGTATCTAT

Full Affymetrix probeset data:

Annotations for 1628791_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720