FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628792_at:

>probe:Drosophila_2:1628792_at:695:195; Interrogation_Position=101; Antisense; AACTGGTGACGGATTGCCTCAAGGA
>probe:Drosophila_2:1628792_at:50:225; Interrogation_Position=121; Antisense; AAGGAGAACGGTGTCACTCCCCAGG
>probe:Drosophila_2:1628792_at:475:451; Interrogation_Position=145; Antisense; GATCTGGCTGACTTGCAATCGGGCA
>probe:Drosophila_2:1628792_at:266:571; Interrogation_Position=18; Antisense; GGCTACATTCGCATTGACTCTGTTG
>probe:Drosophila_2:1628792_at:331:373; Interrogation_Position=201; Antisense; GAAGTGCTCCTCACAGTGCATTCTG
>probe:Drosophila_2:1628792_at:22:345; Interrogation_Position=218; Antisense; GCATTCTGGTCAAGAGCGGTTTCAT
>probe:Drosophila_2:1628792_at:519:539; Interrogation_Position=235; Antisense; GGTTTCATGGACTCCACTGGCAAAC
>probe:Drosophila_2:1628792_at:418:357; Interrogation_Position=254; Antisense; GCAAACTGCTGACCGACAAGATTAA
>probe:Drosophila_2:1628792_at:517:211; Interrogation_Position=277; Antisense; AAGTCTTACTATGCGAACTCGAACT
>probe:Drosophila_2:1628792_at:18:21; Interrogation_Position=323; Antisense; ATTTGGACAGGTGCAGCGCGGTCAA
>probe:Drosophila_2:1628792_at:82:235; Interrogation_Position=355; Antisense; AATGCCTGTGACACTGCCTTCAAGA
>probe:Drosophila_2:1628792_at:260:95; Interrogation_Position=377; Antisense; AGATATTATCCTGCTTCCAGGCAGC
>probe:Drosophila_2:1628792_at:505:337; Interrogation_Position=42; Antisense; GCTCGGCTGCCTTTCAGGAATTTTG
>probe:Drosophila_2:1628792_at:260:583; Interrogation_Position=65; Antisense; TGGCGCAAGCCAACATAGACAGTTC

Paste this into a BLAST search page for me
AACTGGTGACGGATTGCCTCAAGGAAAGGAGAACGGTGTCACTCCCCAGGGATCTGGCTGACTTGCAATCGGGCAGGCTACATTCGCATTGACTCTGTTGGAAGTGCTCCTCACAGTGCATTCTGGCATTCTGGTCAAGAGCGGTTTCATGGTTTCATGGACTCCACTGGCAAACGCAAACTGCTGACCGACAAGATTAAAAGTCTTACTATGCGAACTCGAACTATTTGGACAGGTGCAGCGCGGTCAAAATGCCTGTGACACTGCCTTCAAGAAGATATTATCCTGCTTCCAGGCAGCGCTCGGCTGCCTTTCAGGAATTTTGTGGCGCAAGCCAACATAGACAGTTC

Full Affymetrix probeset data:

Annotations for 1628792_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720