FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628793_at:

>probe:Drosophila_2:1628793_at:468:523; Interrogation_Position=1391; Antisense; GGGCCTGCATGTCTACCAACAGTTC
>probe:Drosophila_2:1628793_at:123:125; Interrogation_Position=1405; Antisense; ACCAACAGTTCGAGGGCTTCGGCCA
>probe:Drosophila_2:1628793_at:564:617; Interrogation_Position=1447; Antisense; TGCTTCGGAGGAGCAGTCGAAAACT
>probe:Drosophila_2:1628793_at:378:195; Interrogation_Position=1468; Antisense; AACTGGTCAAGTTCGTGAGCATGTG
>probe:Drosophila_2:1628793_at:297:101; Interrogation_Position=1588; Antisense; AGAGATTGGGCTGTGTTCGTTGATA
>probe:Drosophila_2:1628793_at:625:715; Interrogation_Position=1603; Antisense; TTCGTTGATATTCCGTCGTCACCTT
>probe:Drosophila_2:1628793_at:334:477; Interrogation_Position=1631; Antisense; GTCTTACCGATACACTTTCCCAGGG
>probe:Drosophila_2:1628793_at:499:539; Interrogation_Position=1655; Antisense; GGTATAGCTCTTTTCTGGCATATGA
>probe:Drosophila_2:1628793_at:507:15; Interrogation_Position=1687; Antisense; ATTATTCATTTAATCCGCCCACGAT
>probe:Drosophila_2:1628793_at:144:233; Interrogation_Position=1698; Antisense; AATCCGCCCACGATGCAATTAATTA
>probe:Drosophila_2:1628793_at:604:1; Interrogation_Position=1719; Antisense; ATTAACACAACCCTCAGTCGGAATT
>probe:Drosophila_2:1628793_at:94:179; Interrogation_Position=1794; Antisense; AAACATAATTCATAAGTGCCTTGCA
>probe:Drosophila_2:1628793_at:139:507; Interrogation_Position=1809; Antisense; GTGCCTTGCAAATCCCTTGAATTTT
>probe:Drosophila_2:1628793_at:204:15; Interrogation_Position=1829; Antisense; ATTTTCATCTCGTAATAAGCGTTGG

Paste this into a BLAST search page for me
GGGCCTGCATGTCTACCAACAGTTCACCAACAGTTCGAGGGCTTCGGCCATGCTTCGGAGGAGCAGTCGAAAACTAACTGGTCAAGTTCGTGAGCATGTGAGAGATTGGGCTGTGTTCGTTGATATTCGTTGATATTCCGTCGTCACCTTGTCTTACCGATACACTTTCCCAGGGGGTATAGCTCTTTTCTGGCATATGAATTATTCATTTAATCCGCCCACGATAATCCGCCCACGATGCAATTAATTAATTAACACAACCCTCAGTCGGAATTAAACATAATTCATAAGTGCCTTGCAGTGCCTTGCAAATCCCTTGAATTTTATTTTCATCTCGTAATAAGCGTTGG

Full Affymetrix probeset data:

Annotations for 1628793_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720