FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628796_at:

>probe:Drosophila_2:1628796_at:692:693; Interrogation_Position=627; Antisense; TTTGCCTGTCTCCATTAATCATAAG
>probe:Drosophila_2:1628796_at:647:659; Interrogation_Position=672; Antisense; TAAAAACCGCTGCATAAGCCCCGAA
>probe:Drosophila_2:1628796_at:553:163; Interrogation_Position=697; Antisense; AAATTTGCAATCTCTCGTGCTGCGA
>probe:Drosophila_2:1628796_at:249:405; Interrogation_Position=720; Antisense; GACTGCATCCCTTGTCGATGAGGAT
>probe:Drosophila_2:1628796_at:426:175; Interrogation_Position=756; Antisense; AAACCACTCGATTGTGCGGCTGCAA
>probe:Drosophila_2:1628796_at:57:363; Interrogation_Position=783; Antisense; GCAATTAGGACTGGCTTCCTTCTCA
>probe:Drosophila_2:1628796_at:605:651; Interrogation_Position=825; Antisense; TCAAGATTTACCCTTTTGCCTTCGA
>probe:Drosophila_2:1628796_at:111:721; Interrogation_Position=840; Antisense; TTGCCTTCGAATTTTTTGTGTACTA
>probe:Drosophila_2:1628796_at:716:693; Interrogation_Position=876; Antisense; TTTGCCCACTGCTTTGTGAATTGGC
>probe:Drosophila_2:1628796_at:662:565; Interrogation_Position=898; Antisense; GGCAACGTGTTGAATTCCCAGACAA
>probe:Drosophila_2:1628796_at:305:49; Interrogation_Position=923; Antisense; ATGCCGAATTTGTTGTCCTTTCCCA
>probe:Drosophila_2:1628796_at:518:69; Interrogation_Position=947; Antisense; AGGCCCCAGTTCAATGCACTTTTTA
>probe:Drosophila_2:1628796_at:318:355; Interrogation_Position=962; Antisense; GCACTTTTTATTCGGCAGCCTTCAG
>probe:Drosophila_2:1628796_at:196:723; Interrogation_Position=990; Antisense; TTGCTGACGCGTTGGGTTGCATTAA

Paste this into a BLAST search page for me
TTTGCCTGTCTCCATTAATCATAAGTAAAAACCGCTGCATAAGCCCCGAAAAATTTGCAATCTCTCGTGCTGCGAGACTGCATCCCTTGTCGATGAGGATAAACCACTCGATTGTGCGGCTGCAAGCAATTAGGACTGGCTTCCTTCTCATCAAGATTTACCCTTTTGCCTTCGATTGCCTTCGAATTTTTTGTGTACTATTTGCCCACTGCTTTGTGAATTGGCGGCAACGTGTTGAATTCCCAGACAAATGCCGAATTTGTTGTCCTTTCCCAAGGCCCCAGTTCAATGCACTTTTTAGCACTTTTTATTCGGCAGCCTTCAGTTGCTGACGCGTTGGGTTGCATTAA

Full Affymetrix probeset data:

Annotations for 1628796_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720