Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628798_at:

>probe:Drosophila_2:1628798_at:592:113; Interrogation_Position=103; Antisense; AGCAGTAGTACGTTATTGGCCGAAA
>probe:Drosophila_2:1628798_at:19:291; Interrogation_Position=137; Antisense; CGGAGGTCAAGGAGCGGCCCATAAC
>probe:Drosophila_2:1628798_at:338:419; Interrogation_Position=172; Antisense; GAGCTCATCTCCATGGAAACTCTGC
>probe:Drosophila_2:1628798_at:503:575; Interrogation_Position=215; Antisense; GGCCAGAGCGTTTTCCCGGAATGGA
>probe:Drosophila_2:1628798_at:730:369; Interrogation_Position=233; Antisense; GAATGGACGAGTTCCTCTCCATGAG
>probe:Drosophila_2:1628798_at:297:193; Interrogation_Position=286; Antisense; AACTACACCAGCAATCTGACCGATG
>probe:Drosophila_2:1628798_at:492:191; Interrogation_Position=30; Antisense; AACTACGGATTTGCTTTCTACAGAA
>probe:Drosophila_2:1628798_at:653:95; Interrogation_Position=323; Antisense; AGATTAATGAACTAGCCCAGCTCCC
>probe:Drosophila_2:1628798_at:623:633; Interrogation_Position=344; Antisense; TCCCTCCCGAGGATCTGATCGATAA
>probe:Drosophila_2:1628798_at:544:161; Interrogation_Position=389; Antisense; AAATTTACCAGCTGGGACTGCGTGA
>probe:Drosophila_2:1628798_at:521:403; Interrogation_Position=426; Antisense; GACTCGTGGGAAACTGCTGGGCATC
>probe:Drosophila_2:1628798_at:198:595; Interrogation_Position=443; Antisense; TGGGCATCTTTGACCGGGATCGCGC
>probe:Drosophila_2:1628798_at:597:389; Interrogation_Position=52; Antisense; GAAACCATTCTAAAAGCGGCGGACG
>probe:Drosophila_2:1628798_at:159:227; Interrogation_Position=88; Antisense; AAGGCTTCAGCGTCCAGCAGTAGTA

Paste this into a BLAST search page for me
AGCAGTAGTACGTTATTGGCCGAAACGGAGGTCAAGGAGCGGCCCATAACGAGCTCATCTCCATGGAAACTCTGCGGCCAGAGCGTTTTCCCGGAATGGAGAATGGACGAGTTCCTCTCCATGAGAACTACACCAGCAATCTGACCGATGAACTACGGATTTGCTTTCTACAGAAAGATTAATGAACTAGCCCAGCTCCCTCCCTCCCGAGGATCTGATCGATAAAAATTTACCAGCTGGGACTGCGTGAGACTCGTGGGAAACTGCTGGGCATCTGGGCATCTTTGACCGGGATCGCGCGAAACCATTCTAAAAGCGGCGGACGAAGGCTTCAGCGTCCAGCAGTAGTA

Full Affymetrix probeset data:

Annotations for 1628798_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime