FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628799_at:

>probe:Drosophila_2:1628799_at:592:561; Interrogation_Position=1011; Antisense; GGAACTATTTATTTCTCTGCGTAAA
>probe:Drosophila_2:1628799_at:662:219; Interrogation_Position=1056; Antisense; AAGTGCATGGGTTCTGTTCGCGCTC
>probe:Drosophila_2:1628799_at:520:469; Interrogation_Position=1071; Antisense; GTTCGCGCTCGATTGCAAGTGACTA
>probe:Drosophila_2:1628799_at:95:119; Interrogation_Position=506; Antisense; AGCTGCGGCGCGAAATCGACGACTA
>probe:Drosophila_2:1628799_at:567:423; Interrogation_Position=589; Antisense; GAGAAATTCCGCGATCAGTGCATGG
>probe:Drosophila_2:1628799_at:622:339; Interrogation_Position=627; Antisense; GCTAATCACACAATCCGAACTGCTG
>probe:Drosophila_2:1628799_at:262:195; Interrogation_Position=644; Antisense; AACTGCTGATCGATCGGGTGCGCGT
>probe:Drosophila_2:1628799_at:80:413; Interrogation_Position=703; Antisense; GACCGCATACTGAAGCTGCTCGAGA
>probe:Drosophila_2:1628799_at:225:433; Interrogation_Position=745; Antisense; GAGTCCAACAGCAGTGCACGCATGT
>probe:Drosophila_2:1628799_at:313:109; Interrogation_Position=788; Antisense; AGAAGATCGAGCAGTTCCGCTCCGA
>probe:Drosophila_2:1628799_at:730:437; Interrogation_Position=817; Antisense; GAGGACATCGATCGCAGCCTGGACA
>probe:Drosophila_2:1628799_at:691:453; Interrogation_Position=864; Antisense; GATCAACAACCAGAGCGTCGACAGT
>probe:Drosophila_2:1628799_at:298:211; Interrogation_Position=901; Antisense; AAGACCACGTCGCTGGCGTTTGAGT
>probe:Drosophila_2:1628799_at:213:193; Interrogation_Position=953; Antisense; AACTGCCTTCGATCGGATTAGTGAG

Paste this into a BLAST search page for me
GGAACTATTTATTTCTCTGCGTAAAAAGTGCATGGGTTCTGTTCGCGCTCGTTCGCGCTCGATTGCAAGTGACTAAGCTGCGGCGCGAAATCGACGACTAGAGAAATTCCGCGATCAGTGCATGGGCTAATCACACAATCCGAACTGCTGAACTGCTGATCGATCGGGTGCGCGTGACCGCATACTGAAGCTGCTCGAGAGAGTCCAACAGCAGTGCACGCATGTAGAAGATCGAGCAGTTCCGCTCCGAGAGGACATCGATCGCAGCCTGGACAGATCAACAACCAGAGCGTCGACAGTAAGACCACGTCGCTGGCGTTTGAGTAACTGCCTTCGATCGGATTAGTGAG

Full Affymetrix probeset data:

Annotations for 1628799_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720