FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628800_at:

>probe:Drosophila_2:1628800_at:404:647; Interrogation_Position=389; Antisense; TCATCATCCACTCCGGCTGGAACAG
>probe:Drosophila_2:1628800_at:462:561; Interrogation_Position=407; Antisense; GGAACAGCGCTAACCTGCGCAACGA
>probe:Drosophila_2:1628800_at:95:495; Interrogation_Position=484; Antisense; GTCAAGCTGCCAAGCATCTCCAACT
>probe:Drosophila_2:1628800_at:523:669; Interrogation_Position=511; Antisense; TACTCGACCTTCGTCGGTGACGTCG
>probe:Drosophila_2:1628800_at:345:85; Interrogation_Position=562; Antisense; AGTGACACCTCCAGTGGTGTGGCTA
>probe:Drosophila_2:1628800_at:278:571; Interrogation_Position=582; Antisense; GGCTACCAATCTTCAGTATGTCGAC
>probe:Drosophila_2:1628800_at:174:485; Interrogation_Position=597; Antisense; GTATGTCGACCTGACTGTGATCACC
>probe:Drosophila_2:1628800_at:97:597; Interrogation_Position=612; Antisense; TGTGATCACCAACACCAAGTGCGCC
>probe:Drosophila_2:1628800_at:599:591; Interrogation_Position=731; Antisense; TGGTCCTCAAGTCGTCCAGCGAGCA
>probe:Drosophila_2:1628800_at:576:113; Interrogation_Position=752; Antisense; AGCAGATCGGTCTGACCTCATTCGG
>probe:Drosophila_2:1628800_at:60:643; Interrogation_Position=781; Antisense; TCTGCCGGTTGCGAGAAGGGCTACC
>probe:Drosophila_2:1628800_at:177:407; Interrogation_Position=838; Antisense; GACTGGATCAAGACTAACACTGGCA
>probe:Drosophila_2:1628800_at:398:187; Interrogation_Position=853; Antisense; AACACTGGCATCTAGGAAGGAGTCA
>probe:Drosophila_2:1628800_at:536:549; Interrogation_Position=871; Antisense; GGAGTCAGGAACTACAATTTCGCTT

Paste this into a BLAST search page for me
TCATCATCCACTCCGGCTGGAACAGGGAACAGCGCTAACCTGCGCAACGAGTCAAGCTGCCAAGCATCTCCAACTTACTCGACCTTCGTCGGTGACGTCGAGTGACACCTCCAGTGGTGTGGCTAGGCTACCAATCTTCAGTATGTCGACGTATGTCGACCTGACTGTGATCACCTGTGATCACCAACACCAAGTGCGCCTGGTCCTCAAGTCGTCCAGCGAGCAAGCAGATCGGTCTGACCTCATTCGGTCTGCCGGTTGCGAGAAGGGCTACCGACTGGATCAAGACTAACACTGGCAAACACTGGCATCTAGGAAGGAGTCAGGAGTCAGGAACTACAATTTCGCTT

Full Affymetrix probeset data:

Annotations for 1628800_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720