FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628801_at:

>probe:Drosophila_2:1628801_at:508:201; Interrogation_Position=7173; Antisense; AATCCCGACTTTATGGCCGCCGCAG
>probe:Drosophila_2:1628801_at:376:187; Interrogation_Position=7231; Antisense; AACAGCGCGTTGTTCCCGGAGGAAT
>probe:Drosophila_2:1628801_at:519:57; Interrogation_Position=7254; Antisense; ATGATGGCCGGCAACCGGAACCAGT
>probe:Drosophila_2:1628801_at:78:563; Interrogation_Position=7270; Antisense; GGAACCAGTACATGAACCAGGCGCC
>probe:Drosophila_2:1628801_at:431:191; Interrogation_Position=7284; Antisense; AACCAGGCGCCCAACGTAACCATGT
>probe:Drosophila_2:1628801_at:312:491; Interrogation_Position=7299; Antisense; GTAACCATGTCCACCATGATGGGTC
>probe:Drosophila_2:1628801_at:19:189; Interrogation_Position=7441; Antisense; AACAGCAGCTGAGGCACCAAATGAT
>probe:Drosophila_2:1628801_at:211:507; Interrogation_Position=7563; Antisense; GTGCCGCAGCAGCAGAGCATGAACC
>probe:Drosophila_2:1628801_at:515:175; Interrogation_Position=7594; Antisense; AAACGCCGAATCTGGTGGCTCAGCT
>probe:Drosophila_2:1628801_at:178:263; Interrogation_Position=7614; Antisense; CAGCTCCAGCGGCAGAACATGATGG
>probe:Drosophila_2:1628801_at:55:115; Interrogation_Position=7642; Antisense; AGCAGCAGTATCAACCACCACCGTA
>probe:Drosophila_2:1628801_at:694:123; Interrogation_Position=7658; Antisense; ACCACCGTACTAGATCGAAGACACT
>probe:Drosophila_2:1628801_at:617:373; Interrogation_Position=7674; Antisense; GAAGACACTTCTTAATCGTAAGCCT
>probe:Drosophila_2:1628801_at:700:289; Interrogation_Position=7689; Antisense; TCGTAAGCCTAGTCCTAATCCTTTA

Paste this into a BLAST search page for me
AATCCCGACTTTATGGCCGCCGCAGAACAGCGCGTTGTTCCCGGAGGAATATGATGGCCGGCAACCGGAACCAGTGGAACCAGTACATGAACCAGGCGCCAACCAGGCGCCCAACGTAACCATGTGTAACCATGTCCACCATGATGGGTCAACAGCAGCTGAGGCACCAAATGATGTGCCGCAGCAGCAGAGCATGAACCAAACGCCGAATCTGGTGGCTCAGCTCAGCTCCAGCGGCAGAACATGATGGAGCAGCAGTATCAACCACCACCGTAACCACCGTACTAGATCGAAGACACTGAAGACACTTCTTAATCGTAAGCCTTCGTAAGCCTAGTCCTAATCCTTTA

Full Affymetrix probeset data:

Annotations for 1628801_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720