Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628802_at:

>probe:Drosophila_2:1628802_at:692:369; Interrogation_Position=180; Antisense; GAAGGACGAAGCACAGCCGGTAAAA
>probe:Drosophila_2:1628802_at:48:279; Interrogation_Position=213; Antisense; CTACGTGGAGGATCAGGACGCGCCT
>probe:Drosophila_2:1628802_at:45:359; Interrogation_Position=267; Antisense; GCAAACGCACATTTGGCGCAGACTG
>probe:Drosophila_2:1628802_at:133:553; Interrogation_Position=306; Antisense; GGAGCAAATCGAGTTCTCTCTGGAT
>probe:Drosophila_2:1628802_at:361:281; Interrogation_Position=321; Antisense; CTCTCTGGATGTACCCAATGGCGTA
>probe:Drosophila_2:1628802_at:168:169; Interrogation_Position=370; Antisense; AAAGTCAAGCTCGTGTCCAATGCCG
>probe:Drosophila_2:1628802_at:252:475; Interrogation_Position=421; Antisense; GTGGAAGGTCCTGCAGGTCCGAAAA
>probe:Drosophila_2:1628802_at:284:587; Interrogation_Position=503; Antisense; TGGACTCTGTGGTGGTCACTGGCAA
>probe:Drosophila_2:1628802_at:570:537; Interrogation_Position=516; Antisense; GGTCACTGGCAACTCCATACTGGAA
>probe:Drosophila_2:1628802_at:639:103; Interrogation_Position=572; Antisense; AGACGCGCCACGACAAAGTGTTCCA
>probe:Drosophila_2:1628802_at:347:221; Interrogation_Position=587; Antisense; AAGTGTTCCAGTACAGAGCCAGCGA
>probe:Drosophila_2:1628802_at:336:103; Interrogation_Position=601; Antisense; AGAGCCAGCGATCCGAATGCAACCA
>probe:Drosophila_2:1628802_at:381:191; Interrogation_Position=626; Antisense; AACTTGTGGCCATTGAACCCACCAA
>probe:Drosophila_2:1628802_at:384:137; Interrogation_Position=650; Antisense; ACGAGTTCACCAAGCGGAGGCGACA

Paste this into a BLAST search page for me
GAAGGACGAAGCACAGCCGGTAAAACTACGTGGAGGATCAGGACGCGCCTGCAAACGCACATTTGGCGCAGACTGGGAGCAAATCGAGTTCTCTCTGGATCTCTCTGGATGTACCCAATGGCGTAAAAGTCAAGCTCGTGTCCAATGCCGGTGGAAGGTCCTGCAGGTCCGAAAATGGACTCTGTGGTGGTCACTGGCAAGGTCACTGGCAACTCCATACTGGAAAGACGCGCCACGACAAAGTGTTCCAAAGTGTTCCAGTACAGAGCCAGCGAAGAGCCAGCGATCCGAATGCAACCAAACTTGTGGCCATTGAACCCACCAAACGAGTTCACCAAGCGGAGGCGACA

Full Affymetrix probeset data:

Annotations for 1628802_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime