FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628804_at:

>probe:Drosophila_2:1628804_at:290:15; Interrogation_Position=1032; Antisense; ATTATGTGTTCGATTTCCTTGCAGC
>probe:Drosophila_2:1628804_at:517:617; Interrogation_Position=1047; Antisense; TCCTTGCAGCTTTCAACGTCTTGTA
>probe:Drosophila_2:1628804_at:472:197; Interrogation_Position=1061; Antisense; AACGTCTTGTAGTGATCCTTCTCCT
>probe:Drosophila_2:1628804_at:526:95; Interrogation_Position=523; Antisense; AGATTGCTGTGATCTCGAACCACCA
>probe:Drosophila_2:1628804_at:32:111; Interrogation_Position=547; Antisense; AGAATGGCAGGGACACCCACATGCG
>probe:Drosophila_2:1628804_at:480:359; Interrogation_Position=601; Antisense; GCAAGCACTATCCTCTGGAACTGTT
>probe:Drosophila_2:1628804_at:408:691; Interrogation_Position=624; Antisense; TTTGGCAAGTTTGGAACGGTCGACT
>probe:Drosophila_2:1628804_at:422:1; Interrogation_Position=639; Antisense; ACGGTCGACTTTCAGAAGTTCGCCA
>probe:Drosophila_2:1628804_at:93:375; Interrogation_Position=653; Antisense; GAAGTTCGCCACCATTCGTTAGGGA
>probe:Drosophila_2:1628804_at:13:531; Interrogation_Position=786; Antisense; GGTGTTTCTAATTAAATGCCCGTCA
>probe:Drosophila_2:1628804_at:633:233; Interrogation_Position=800; Antisense; AATGCCCGTCACTTGTATATATATA
>probe:Drosophila_2:1628804_at:603:685; Interrogation_Position=844; Antisense; TATACCGTCGTCTAAGCTTAAGTAC
>probe:Drosophila_2:1628804_at:462:689; Interrogation_Position=903; Antisense; TATTGTTACTGTTTTATCGCGATAC
>probe:Drosophila_2:1628804_at:653:481; Interrogation_Position=988; Antisense; GTATTGTATTGCACTATCTCGAGGA

Paste this into a BLAST search page for me
ATTATGTGTTCGATTTCCTTGCAGCTCCTTGCAGCTTTCAACGTCTTGTAAACGTCTTGTAGTGATCCTTCTCCTAGATTGCTGTGATCTCGAACCACCAAGAATGGCAGGGACACCCACATGCGGCAAGCACTATCCTCTGGAACTGTTTTTGGCAAGTTTGGAACGGTCGACTACGGTCGACTTTCAGAAGTTCGCCAGAAGTTCGCCACCATTCGTTAGGGAGGTGTTTCTAATTAAATGCCCGTCAAATGCCCGTCACTTGTATATATATATATACCGTCGTCTAAGCTTAAGTACTATTGTTACTGTTTTATCGCGATACGTATTGTATTGCACTATCTCGAGGA

Full Affymetrix probeset data:

Annotations for 1628804_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720