FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628806_at:

>probe:Drosophila_2:1628806_at:325:283; Interrogation_Position=1029; Antisense; CTGCAAGTCGGTGTCCTGTCTGGAT
>probe:Drosophila_2:1628806_at:244:597; Interrogation_Position=1045; Antisense; TGTCTGGATCCCTGGGTCTATGCCA
>probe:Drosophila_2:1628806_at:687:217; Interrogation_Position=1081; Antisense; AAGTATCGTCTGGAGCTGGAGCGCC
>probe:Drosophila_2:1628806_at:279:423; Interrogation_Position=1129; Antisense; GAGAAGCATGCCACATCCGGAACAT
>probe:Drosophila_2:1628806_at:728:521; Interrogation_Position=1171; Antisense; GTGGCCAGTGTCAGCGGCGATACTT
>probe:Drosophila_2:1628806_at:634:455; Interrogation_Position=1189; Antisense; GATACTTTGGCACTCAGCGTGCAAA
>probe:Drosophila_2:1628806_at:569:45; Interrogation_Position=760; Antisense; ATCCTGGTGTCCTACTACAAGCTCT
>probe:Drosophila_2:1628806_at:505:139; Interrogation_Position=791; Antisense; ACGTCCGCGTGCACGAGAAGATGCT
>probe:Drosophila_2:1628806_at:499:613; Interrogation_Position=836; Antisense; TGAACGTGAAGTCGCTGTCGGCCAA
>probe:Drosophila_2:1628806_at:648:607; Interrogation_Position=878; Antisense; TGAGTGTGGAACTCCGGATCGCCAA
>probe:Drosophila_2:1628806_at:502:307; Interrogation_Position=899; Antisense; CCAAGGCGGCCCTCATAATATACAT
>probe:Drosophila_2:1628806_at:144:23; Interrogation_Position=916; Antisense; ATATACATGCTCTTCATTCTGGCCT
>probe:Drosophila_2:1628806_at:79:519; Interrogation_Position=955; Antisense; GTGGTGGCACTTATCGGATGCTTCG
>probe:Drosophila_2:1628806_at:272:529; Interrogation_Position=980; Antisense; GGGAGCAGCAGCTAATCACGCCCTT

Paste this into a BLAST search page for me
CTGCAAGTCGGTGTCCTGTCTGGATTGTCTGGATCCCTGGGTCTATGCCAAAGTATCGTCTGGAGCTGGAGCGCCGAGAAGCATGCCACATCCGGAACATGTGGCCAGTGTCAGCGGCGATACTTGATACTTTGGCACTCAGCGTGCAAAATCCTGGTGTCCTACTACAAGCTCTACGTCCGCGTGCACGAGAAGATGCTTGAACGTGAAGTCGCTGTCGGCCAATGAGTGTGGAACTCCGGATCGCCAACCAAGGCGGCCCTCATAATATACATATATACATGCTCTTCATTCTGGCCTGTGGTGGCACTTATCGGATGCTTCGGGGAGCAGCAGCTAATCACGCCCTT

Full Affymetrix probeset data:

Annotations for 1628806_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720