FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628807_at:

>probe:Drosophila_2:1628807_at:6:563; Interrogation_Position=6447; Antisense; GGCAACTCCGCGACTTGGACGTCTA
>probe:Drosophila_2:1628807_at:193:557; Interrogation_Position=6463; Antisense; GGACGTCTACAGCTTACGCTTTATT
>probe:Drosophila_2:1628807_at:48:709; Interrogation_Position=6487; Antisense; TTAATGTCCGACTGCCTTATGGGCT
>probe:Drosophila_2:1628807_at:576:63; Interrogation_Position=6505; Antisense; ATGGGCTTTGACCAGCAGTACGACC
>probe:Drosophila_2:1628807_at:700:487; Interrogation_Position=6522; Antisense; GTACGACCTGCAATTCGAGATCATT
>probe:Drosophila_2:1628807_at:394:221; Interrogation_Position=6589; Antisense; AAGTGTACCGTAGCATTCTGTAGAG
>probe:Drosophila_2:1628807_at:183:475; Interrogation_Position=6631; Antisense; GTTAATGGAGTTCATATCGCCTATG
>probe:Drosophila_2:1628807_at:483:623; Interrogation_Position=6647; Antisense; TCGCCTATGAACGTTTTCCACAATC
>probe:Drosophila_2:1628807_at:696:33; Interrogation_Position=6669; Antisense; ATCACTGTTATCACCTAGAGTTCGT
>probe:Drosophila_2:1628807_at:525:721; Interrogation_Position=6707; Antisense; TTGCGTATTTATTGTGTGATCCTCC
>probe:Drosophila_2:1628807_at:214:513; Interrogation_Position=6722; Antisense; GTGATCCTCCAAGACATGTATAACA
>probe:Drosophila_2:1628807_at:231:273; Interrogation_Position=6754; Antisense; CATTAGTAACTTGCTTCGAGACGAA
>probe:Drosophila_2:1628807_at:179:105; Interrogation_Position=6772; Antisense; AGACGAAGCTCCTTTGTTAGCCAAC
>probe:Drosophila_2:1628807_at:102:475; Interrogation_Position=6787; Antisense; GTTAGCCAACCATGTAGCACCTACA

Paste this into a BLAST search page for me
GGCAACTCCGCGACTTGGACGTCTAGGACGTCTACAGCTTACGCTTTATTTTAATGTCCGACTGCCTTATGGGCTATGGGCTTTGACCAGCAGTACGACCGTACGACCTGCAATTCGAGATCATTAAGTGTACCGTAGCATTCTGTAGAGGTTAATGGAGTTCATATCGCCTATGTCGCCTATGAACGTTTTCCACAATCATCACTGTTATCACCTAGAGTTCGTTTGCGTATTTATTGTGTGATCCTCCGTGATCCTCCAAGACATGTATAACACATTAGTAACTTGCTTCGAGACGAAAGACGAAGCTCCTTTGTTAGCCAACGTTAGCCAACCATGTAGCACCTACA

Full Affymetrix probeset data:

Annotations for 1628807_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720