Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628809_at:

>probe:Drosophila_2:1628809_at:113:615; Interrogation_Position=2309; Antisense; TGAAGCGCCAGCAGCCGAAGAATTT
>probe:Drosophila_2:1628809_at:155:243; Interrogation_Position=2329; Antisense; AATTTCGAGCAATACCAGGATCCGG
>probe:Drosophila_2:1628809_at:693:361; Interrogation_Position=2337; Antisense; GCAATACCAGGATCCGGCGGCGGAA
>probe:Drosophila_2:1628809_at:611:119; Interrogation_Position=2381; Antisense; AGCTGCTGGCCTACCAGATCGAGGA
>probe:Drosophila_2:1628809_at:338:375; Interrogation_Position=2442; Antisense; GAAGATCCAGGAGGCTGCCTTCGAG
>probe:Drosophila_2:1628809_at:310:281; Interrogation_Position=2479; Antisense; CTGCAGAAGCAGTCGAACACTTACG
>probe:Drosophila_2:1628809_at:495:707; Interrogation_Position=2499; Antisense; TTACGACGGCTTCTACGCGCAGAAG
>probe:Drosophila_2:1628809_at:116:83; Interrogation_Position=2534; Antisense; AGGGCACCTCAGTGGACGCACTGAA
>probe:Drosophila_2:1628809_at:261:409; Interrogation_Position=2548; Antisense; GACGCACTGAAGTTGGATCATGTTT
>probe:Drosophila_2:1628809_at:213:545; Interrogation_Position=2562; Antisense; GGATCATGTTTGAGCGGCAGAATCA
>probe:Drosophila_2:1628809_at:320:167; Interrogation_Position=2592; Antisense; AAATGCTTGCGAGCAAACCCGGCCT
>probe:Drosophila_2:1628809_at:173:283; Interrogation_Position=2615; Antisense; CTCCGTTTCCGATCATTTCATTATG
>probe:Drosophila_2:1628809_at:104:541; Interrogation_Position=2677; Antisense; GGATTACCAACTAGTTTTCGTCACT
>probe:Drosophila_2:1628809_at:492:477; Interrogation_Position=2690; Antisense; GTTTTCGTCACTTTGCAATTTGATC

Paste this into a BLAST search page for me
TGAAGCGCCAGCAGCCGAAGAATTTAATTTCGAGCAATACCAGGATCCGGGCAATACCAGGATCCGGCGGCGGAAAGCTGCTGGCCTACCAGATCGAGGAGAAGATCCAGGAGGCTGCCTTCGAGCTGCAGAAGCAGTCGAACACTTACGTTACGACGGCTTCTACGCGCAGAAGAGGGCACCTCAGTGGACGCACTGAAGACGCACTGAAGTTGGATCATGTTTGGATCATGTTTGAGCGGCAGAATCAAAATGCTTGCGAGCAAACCCGGCCTCTCCGTTTCCGATCATTTCATTATGGGATTACCAACTAGTTTTCGTCACTGTTTTCGTCACTTTGCAATTTGATC

Full Affymetrix probeset data:

Annotations for 1628809_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime