Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628810_at:

>probe:Drosophila_2:1628810_at:354:55; Interrogation_Position=107; Antisense; ATGAAACCATCCTGGCAACCGCCAA
>probe:Drosophila_2:1628810_at:73:537; Interrogation_Position=136; Antisense; GGTCTCCTCAGTCTGCTCAAGGGAG
>probe:Drosophila_2:1628810_at:187:539; Interrogation_Position=17; Antisense; GGTTTGGTCAGTCAGGCAGCTTTAA
>probe:Drosophila_2:1628810_at:525:531; Interrogation_Position=22; Antisense; GGTCAGTCAGGCAGCTTTAAATCGA
>probe:Drosophila_2:1628810_at:10:577; Interrogation_Position=241; Antisense; GGCGAGAGCACCGTGAAGGTCATTA
>probe:Drosophila_2:1628810_at:431:489; Interrogation_Position=259; Antisense; GTCATTAAAGTGATAACCGATTCCG
>probe:Drosophila_2:1628810_at:516:279; Interrogation_Position=369; Antisense; CTACGGAGGTGGCAGCACTGTTAAA
>probe:Drosophila_2:1628810_at:330:521; Interrogation_Position=377; Antisense; GTGGCAGCACTGTTAAAATTATTAA
>probe:Drosophila_2:1628810_at:181:5; Interrogation_Position=409; Antisense; ACCGATTCCGGATCCGGCTACGGAG
>probe:Drosophila_2:1628810_at:659:207; Interrogation_Position=47; Antisense; AAGCAAACTTGGCTTTTGGCATTAG
>probe:Drosophila_2:1628810_at:356:271; Interrogation_Position=54; Antisense; CTTGGCTTTTGGCATTAGTTCTACT
>probe:Drosophila_2:1628810_at:401:15; Interrogation_Position=67; Antisense; ATTAGTTCTACTTGTGCCTCTCGAG
>probe:Drosophila_2:1628810_at:400:729; Interrogation_Position=78; Antisense; TTGTGCCTCTCGAGCGTTCGCAGTC
>probe:Drosophila_2:1628810_at:336:711; Interrogation_Position=94; Antisense; TTCGCAGTCCGCAATGAAACCATCC

Paste this into a BLAST search page for me
ATGAAACCATCCTGGCAACCGCCAAGGTCTCCTCAGTCTGCTCAAGGGAGGGTTTGGTCAGTCAGGCAGCTTTAAGGTCAGTCAGGCAGCTTTAAATCGAGGCGAGAGCACCGTGAAGGTCATTAGTCATTAAAGTGATAACCGATTCCGCTACGGAGGTGGCAGCACTGTTAAAGTGGCAGCACTGTTAAAATTATTAAACCGATTCCGGATCCGGCTACGGAGAAGCAAACTTGGCTTTTGGCATTAGCTTGGCTTTTGGCATTAGTTCTACTATTAGTTCTACTTGTGCCTCTCGAGTTGTGCCTCTCGAGCGTTCGCAGTCTTCGCAGTCCGCAATGAAACCATCC

Full Affymetrix probeset data:

Annotations for 1628810_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime